Incidental Mutation 'R5817:Ahcyl2'
ID449090
Institutional Source Beutler Lab
Gene Symbol Ahcyl2
Ensembl Gene ENSMUSG00000029772
Gene NameS-adenosylhomocysteine hydrolase-like 2
Synonyms
MMRRC Submission 043397-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29768011-29912310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29890721 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 292 (V292M)
Ref Sequence ENSEMBL: ENSMUSP00000110893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064872] [ENSMUST00000102995] [ENSMUST00000115238] [ENSMUST00000115242] [ENSMUST00000125911]
Predicted Effect probably damaging
Transcript: ENSMUST00000064872
AA Change: V292M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067638
Gene: ENSMUSG00000029772
AA Change: V292M

DomainStartEndE-ValueType
low complexity region 38 68 N/A INTRINSIC
AdoHcyase 82 507 4.47e-268 SMART
AdoHcyase_NAD 267 428 2.21e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102995
AA Change: V396M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100060
Gene: ENSMUSG00000029772
AA Change: V396M

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 142 172 N/A INTRINSIC
AdoHcyase 186 611 4.47e-268 SMART
AdoHcyase_NAD 371 532 2.21e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115238
AA Change: V292M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110893
Gene: ENSMUSG00000029772
AA Change: V292M

DomainStartEndE-ValueType
low complexity region 38 68 N/A INTRINSIC
AdoHcyase 82 507 4.47e-268 SMART
AdoHcyase_NAD 267 428 2.21e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115242
AA Change: V397M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110897
Gene: ENSMUSG00000029772
AA Change: V397M

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 143 173 N/A INTRINSIC
AdoHcyase 187 612 4.47e-268 SMART
AdoHcyase_NAD 372 533 2.21e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125911
AA Change: V188M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135518
Gene: ENSMUSG00000029772
AA Change: V188M

DomainStartEndE-ValueType
AdoHcyase 1 403 8.07e-243 SMART
AdoHcyase_NAD 163 324 2.21e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201020
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer and may be involved in the conversion of S-adenosyl-L-homocysteine to L-homocysteine and adenosine. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Ahcyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Ahcyl2 APN 6 29880557 missense probably benign 0.03
IGL03072:Ahcyl2 APN 6 29906501 splice site probably benign
IGL03195:Ahcyl2 APN 6 29906769 splice site probably benign
R0189:Ahcyl2 UTSW 6 29891243 missense probably benign 0.32
R0395:Ahcyl2 UTSW 6 29886168 missense probably damaging 1.00
R0555:Ahcyl2 UTSW 6 29890671 critical splice acceptor site probably benign
R0924:Ahcyl2 UTSW 6 29870628 unclassified probably null
R0930:Ahcyl2 UTSW 6 29870628 unclassified probably null
R1413:Ahcyl2 UTSW 6 29768587 utr 5 prime probably benign
R1446:Ahcyl2 UTSW 6 29891240 missense probably damaging 0.96
R1822:Ahcyl2 UTSW 6 29768584 utr 5 prime probably benign
R1864:Ahcyl2 UTSW 6 29908355 missense probably damaging 1.00
R1865:Ahcyl2 UTSW 6 29908355 missense probably damaging 1.00
R3810:Ahcyl2 UTSW 6 29891261 missense probably benign 0.01
R4429:Ahcyl2 UTSW 6 29894875 missense probably damaging 1.00
R4932:Ahcyl2 UTSW 6 29890701 missense probably benign 0.22
R5019:Ahcyl2 UTSW 6 29859739 missense possibly damaging 0.96
R5032:Ahcyl2 UTSW 6 29768556 utr 5 prime probably benign
R5396:Ahcyl2 UTSW 6 29859698 intron probably benign
R5604:Ahcyl2 UTSW 6 29908367 missense probably damaging 1.00
R5959:Ahcyl2 UTSW 6 29886174 missense probably damaging 1.00
R6159:Ahcyl2 UTSW 6 29908458 missense possibly damaging 0.81
R6531:Ahcyl2 UTSW 6 29886162 missense probably benign 0.41
R7025:Ahcyl2 UTSW 6 29908421 missense probably damaging 1.00
R7478:Ahcyl2 UTSW 6 29903267 missense probably damaging 1.00
R7560:Ahcyl2 UTSW 6 29886140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGAGCTCGTTAGATAGAC -3'
(R):5'- GCGATGCTGGAACAAGTCAG -3'

Sequencing Primer
(F):5'- GCTCGTTAGATAGACAAAATACAGAC -3'
(R):5'- TGCTGGAACAAGTCAGAAAATC -3'
Posted On2016-12-20