Incidental Mutation 'R5817:Olfr586'
ID449102
Institutional Source Beutler Lab
Gene Symbol Olfr586
Ensembl Gene ENSMUSG00000066268
Gene Nameolfactory receptor 586
SynonymsMOR8-7, GA_x6K02T2PBJ9-5836380-5835439, MOR8-2
MMRRC Submission 043397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103118403-103125638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103121908 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 292 (M292K)
Ref Sequence ENSEMBL: ENSMUSP00000081872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084811] [ENSMUST00000211075] [ENSMUST00000213281] [ENSMUST00000215304]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084811
AA Change: M292K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081872
Gene: ENSMUSG00000066268
AA Change: M292K

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 6.1e-111 PFAM
Pfam:7TM_GPCR_Srsx 41 312 1.6e-11 PFAM
Pfam:7tm_1 47 297 1.7e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211075
AA Change: M288K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213281
AA Change: M288K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215304
AA Change: M288K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Olfr586
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02708:Olfr586 APN 7 103121820 utr 3 prime probably benign
R0502:Olfr586 UTSW 7 103122436 missense possibly damaging 0.94
R0503:Olfr586 UTSW 7 103122436 missense possibly damaging 0.94
R0508:Olfr586 UTSW 7 103121986 missense possibly damaging 0.93
R0882:Olfr586 UTSW 7 103122575 missense probably benign 0.09
R0962:Olfr586 UTSW 7 103122010 missense possibly damaging 0.50
R1112:Olfr586 UTSW 7 103122404 missense probably damaging 1.00
R2226:Olfr586 UTSW 7 103121908 missense probably benign 0.06
R4285:Olfr586 UTSW 7 103122660 nonsense probably null
R6342:Olfr586 UTSW 7 103122356 missense probably damaging 0.99
R6380:Olfr586 UTSW 7 103121929 missense probably benign 0.02
R6565:Olfr586 UTSW 7 103122238 missense probably damaging 0.99
R7861:Olfr586 UTSW 7 103122692 missense probably benign 0.03
R7921:Olfr586 UTSW 7 103122428 missense probably damaging 0.99
RF020:Olfr586 UTSW 7 103121891 missense probably benign 0.05
Z1177:Olfr586 UTSW 7 103122391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTAACATACAGCATGAGCCC -3'
(R):5'- CAGGCATCCTTGACATAACCTTC -3'

Sequencing Primer
(F):5'- AGCATGAGCCCTTAACTGATTC -3'
(R):5'- TGGGCATTGCATCCCAAAG -3'
Posted On2016-12-20