Incidental Mutation 'R5817:Chst15'
ID449105
Institutional Source Beutler Lab
Gene Symbol Chst15
Ensembl Gene ENSMUSG00000030930
Gene Namecarbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
SynonymsMAd5, GalNAcS-6ST, MAd5, 4631426J05Rik
MMRRC Submission 043397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location132235780-132317228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132269147 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 220 (L220F)
Ref Sequence ENSEMBL: ENSMUSP00000079105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077472] [ENSMUST00000080215] [ENSMUST00000124096]
Predicted Effect probably damaging
Transcript: ENSMUST00000077472
AA Change: L220F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076682
Gene: ENSMUSG00000030930
AA Change: L220F

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 502 4.2e-10 PFAM
Pfam:Sulfotransfer_1 369 524 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080215
AA Change: L220F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079105
Gene: ENSMUSG00000030930
AA Change: L220F

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 499 7.9e-9 PFAM
Pfam:Sulfotransfer_1 369 524 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132508
Meta Mutation Damage Score 0.1670 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size and abnormal bone marrow-derived mast cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Chst15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Chst15 APN 7 132270507 missense probably benign 0.22
IGL01879:Chst15 APN 7 132270265 missense possibly damaging 0.94
IGL02355:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02362:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02826:Chst15 APN 7 132266746 missense probably damaging 1.00
IGL02860:Chst15 APN 7 132269102 missense probably benign
IGL02972:Chst15 APN 7 132269173 missense probably damaging 1.00
IGL03266:Chst15 APN 7 132270076 missense probably damaging 1.00
IGL03331:Chst15 APN 7 132262713 missense probably damaging 1.00
IGL03375:Chst15 APN 7 132270457 nonsense probably null
R1476:Chst15 UTSW 7 132270273 missense possibly damaging 0.95
R1501:Chst15 UTSW 7 132269069 nonsense probably null
R1518:Chst15 UTSW 7 132270126 missense probably damaging 1.00
R1943:Chst15 UTSW 7 132262850 splice site probably null
R2164:Chst15 UTSW 7 132270385 missense probably damaging 0.97
R3947:Chst15 UTSW 7 132247875 missense probably damaging 1.00
R4921:Chst15 UTSW 7 132247884 missense probably benign 0.01
R5817:Chst15 UTSW 7 132269144 missense probably damaging 0.99
R5917:Chst15 UTSW 7 132270517 missense probably benign
R6930:Chst15 UTSW 7 132269030 missense possibly damaging 0.95
R7159:Chst15 UTSW 7 132270258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGCCATGCCTCTGAATC -3'
(R):5'- CCACTCCTAGTTTAGAACATTTCTG -3'

Sequencing Primer
(F):5'- GAGAATTTCACTTCTGGATGCAGCC -3'
(R):5'- TGCTAATTGTTTTCTTTTATTGTGCC -3'
Posted On2016-12-20