Mutagenetix > Incidental Mutations

Incidental Mutation 'R5817:Prag1'

449106

Institutional Source

Beutler Lab

Gene Symbol

Prag1

Ensembl Gene

ENSMUSG00000050271

Gene Name

PEAK1 related kinase activating pseudokinase 1

Synonyms

D8Ertd82e, NACK

MMRRC Submission

043397-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5817 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36094828-36147787 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 36103703 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Proline at position 480 (Q480P)

Ref Sequence

ENSEMBL: ENSMUSP00000106118 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110492]

AlphaFold

Q571I4

Predicted Effect

probably damaging
Transcript: ENSMUST00000110492
AA Change: Q480P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000106118
Gene: ENSMUSG00000050271
AA Change: Q480P

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	395	412	N/A	INTRINSIC
low complexity region	525	544	N/A	INTRINSIC
low complexity region	781	793	N/A	INTRINSIC
low complexity region	892	925	N/A	INTRINSIC
Pfam:Pkinase_Tyr	1060	1288	1.7e-7	PFAM
Pfam:Pkinase	1061	1293	1.5e-13	PFAM
low complexity region	1363	1373	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145386

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150295

Meta Mutation Damage Score

0.1156

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the tyrosine protein kinase family. A similar protein in rat binds to Rho family GTPase 2 (Rnd2) and regulates neurite outgrowth via activation of Ras homolog gene family, member A (RhoA). [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	A	G	4: 144,622,927	I251M	probably benign	Het
Abcf3	T	C	16: 20,549,083	V63A	possibly damaging	Het
Agpat4	C	T	17: 12,215,210		probably benign	Het
Ahcyl2	G	A	6: 29,890,721	V292M	probably damaging	Het
Ahnak2	A	T	12: 112,774,003	F406I	probably damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arhgef5	G	A	6: 43,275,104	D930N	probably benign	Het
Casc4	T	A	2: 121,906,044	S231T	probably benign	Het
Cc2d2a	G	A	5: 43,712,418	R887Q	probably damaging	Het
Ceacam18	A	G	7: 43,641,841	T236A	probably benign	Het
Chst15	A	T	7: 132,269,144	Y221N	probably damaging	Het
Chst15	G	A	7: 132,269,147	L220F	probably damaging	Het
Cntn2	G	A	1: 132,518,748	T784I	probably benign	Het
D630003M21Rik	A	G	2: 158,196,493	L1011P	probably damaging	Het
Dync2h1	T	A	9: 6,996,905	D3894V	probably damaging	Het
E330017A01Rik	T	C	16: 58,636,793	I89V	probably benign	Het
Fam13b	T	C	18: 34,457,797	M443V	possibly damaging	Het
Fam20a	T	A	11: 109,673,418	Q503L	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm21319	G	T	12: 87,773,431	D119E	probably benign	Het
Gm5454	T	A	13: 103,356,632		noncoding transcript	Het
Gm5581	A	G	6: 131,167,169		noncoding transcript	Het
Gm6619	A	G	6: 131,486,437	I6V	unknown	Het
Gmcl1	A	G	6: 86,714,248	M255T	probably damaging	Het
Gprc5c	T	A	11: 114,863,624	C42*	probably null	Het
Hmcn1	T	A	1: 150,737,524	E1384V	possibly damaging	Het
Il6	A	G	5: 30,018,008	I91V	probably benign	Het
Kmt2d	A	T	15: 98,862,363	S1005T	unknown	Het
Map1a	A	T	2: 121,298,910	H143L	possibly damaging	Het
Mical2	A	T	7: 112,323,659	T624S	probably benign	Het
Msh3	A	T	13: 92,286,000	N549K	possibly damaging	Het
Ncr1	T	A	7: 4,340,895	I164N	possibly damaging	Het
Olfr1333	T	G	4: 118,830,099	T115P	probably damaging	Het
Olfr554	A	G	7: 102,640,378	N44S	probably damaging	Het
Olfr586	A	T	7: 103,121,908	M292K	possibly damaging	Het
Olfr926	A	G	9: 38,877,377	D67G	probably damaging	Het
Palmd	T	C	3: 116,918,623	I541M	probably benign	Het
Pcsk7	A	T	9: 45,926,033	M552L	probably benign	Het
Plekhh2	A	G	17: 84,571,726	E626G	possibly damaging	Het
Pole	G	A	5: 110,312,972	D1176N	probably damaging	Het
Polr2f	T	C	15: 79,151,669	I110T	probably damaging	Het
Pomt1	A	T	2: 32,248,679	I436F	probably damaging	Het
Qars	C	T	9: 108,510,242		probably benign	Het
Ralgapa2	G	A	2: 146,333,486	S1797L	probably damaging	Het
Rbm26	T	C	14: 105,128,603	T832A	probably damaging	Het
Rnf169	A	G	7: 99,925,769	S540P	probably benign	Het
Serpini1	T	A	3: 75,613,324	M76K	probably benign	Het
Shq1	A	G	6: 100,573,720	L419S	probably damaging	Het
Slc25a17	G	A	15: 81,327,060	T225M	probably damaging	Het
Slc6a5	C	A	7: 49,956,491	L716I	probably benign	Het
Smc1b	A	G	15: 85,067,783	V1149A	probably damaging	Het
Trappc1	A	T	11: 69,324,234	Q26L	possibly damaging	Het
Trpm2	C	A	10: 77,965,980	G84W	probably damaging	Het
Ttn	G	A	2: 76,742,666	T24215M	probably damaging	Het
Ubn2	C	A	6: 38,479,153	T337K	probably damaging	Het
Ubr4	A	G	4: 139,468,847	K1265E	probably damaging	Het
Vmn1r214	T	G	13: 23,035,321	I328M	probably damaging	Het
Xcr1	C	T	9: 123,855,857	C280Y	possibly damaging	Het
Zc3h13	A	G	14: 75,328,132	E895G	probably damaging	Het

Other mutations in Prag1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Prag1	APN	8	36099931	missense	probably benign	0.01
IGL01132:Prag1	APN	8	36146357	missense	probably damaging	1.00
IGL01322:Prag1	APN	8	36103934	missense	probably benign	0.01
IGL01343:Prag1	APN	8	36103046	missense	possibly damaging	0.95
IGL01726:Prag1	APN	8	36102992	missense	probably damaging	1.00
IGL01739:Prag1	APN	8	36102680	missense	probably benign	0.00
IGL02420:Prag1	APN	8	36147426	utr 3 prime	probably benign
IGL02433:Prag1	APN	8	36139568	missense	probably damaging	1.00
IGL02627:Prag1	APN	8	36139439	missense	possibly damaging	0.93
IGL02797:Prag1	APN	8	36139501	missense	probably damaging	1.00
IGL03070:Prag1	APN	8	36103549	missense	probably benign	0.01
IGL03323:Prag1	APN	8	36140008	missense	probably damaging	1.00
FR4340:Prag1	UTSW	8	36103886	small insertion	probably benign
FR4548:Prag1	UTSW	8	36103885	small insertion	probably benign
FR4589:Prag1	UTSW	8	36103883	small insertion	probably benign
FR4976:Prag1	UTSW	8	36103883	small insertion	probably benign
R0325:Prag1	UTSW	8	36103804	missense	probably benign	0.00
R0486:Prag1	UTSW	8	36146633	missense	probably damaging	1.00
R0506:Prag1	UTSW	8	36103700	missense	possibly damaging	0.92
R0507:Prag1	UTSW	8	36104123	missense	probably damaging	1.00
R0595:Prag1	UTSW	8	36147002	missense	probably damaging	1.00
R0618:Prag1	UTSW	8	36099833	missense	probably damaging	1.00
R0618:Prag1	UTSW	8	36099833	missense	probably damaging	1.00
R0885:Prag1	UTSW	8	36103267	missense	probably benign	0.00
R1015:Prag1	UTSW	8	36146543	missense	probably damaging	1.00
R1168:Prag1	UTSW	8	36146645	missense	probably damaging	1.00
R1182:Prag1	UTSW	8	36147259	missense	possibly damaging	0.95
R1227:Prag1	UTSW	8	36139951	missense	probably damaging	1.00
R1282:Prag1	UTSW	8	36099914	missense	probably damaging	0.96
R1469:Prag1	UTSW	8	36146298	splice site	probably benign
R1656:Prag1	UTSW	8	36104346	missense	probably damaging	1.00
R1660:Prag1	UTSW	8	36140023	missense	possibly damaging	0.73
R1676:Prag1	UTSW	8	36102898	missense	probably damaging	0.96
R1820:Prag1	UTSW	8	36103804	missense	probably benign	0.00
R1970:Prag1	UTSW	8	36129160	splice site	probably null
R1974:Prag1	UTSW	8	36102927	missense	probably damaging	1.00
R4398:Prag1	UTSW	8	36103655	missense	probably damaging	1.00
R4429:Prag1	UTSW	8	36146642	missense	probably damaging	1.00
R4627:Prag1	UTSW	8	36103292	missense	probably damaging	1.00
R4980:Prag1	UTSW	8	36139586	missense	probably damaging	1.00
R5131:Prag1	UTSW	8	36139969	missense	probably damaging	1.00
R5215:Prag1	UTSW	8	36099889	missense	probably benign	0.06
R5346:Prag1	UTSW	8	36103685	missense	probably damaging	1.00
R5414:Prag1	UTSW	8	36139622	missense	probably benign	0.00
R5535:Prag1	UTSW	8	36104014	missense	probably benign
R5687:Prag1	UTSW	8	36146813	missense	probably benign	0.02
R5785:Prag1	UTSW	8	36103487	missense	probably benign	0.35
R6002:Prag1	UTSW	8	36104183	missense	probably benign	0.31
R6127:Prag1	UTSW	8	36147401	missense	unknown
R6240:Prag1	UTSW	8	36103352	missense	probably benign	0.03
R6277:Prag1	UTSW	8	36146591	missense	probably damaging	1.00
R6326:Prag1	UTSW	8	36102706	missense	possibly damaging	0.79
R6741:Prag1	UTSW	8	36147280	missense	probably benign	0.41
R6925:Prag1	UTSW	8	36103894	missense	probably damaging	1.00
R7085:Prag1	UTSW	8	36104237	missense	possibly damaging	0.71
R7095:Prag1	UTSW	8	36102560	missense	probably benign
R7204:Prag1	UTSW	8	36146761	missense	probably benign	0.03
R7213:Prag1	UTSW	8	36146615	missense	probably damaging	0.99
R7567:Prag1	UTSW	8	36102606	missense	possibly damaging	0.68
R7577:Prag1	UTSW	8	36146942	missense	probably damaging	1.00
R7783:Prag1	UTSW	8	36103255	missense	possibly damaging	0.66
R8146:Prag1	UTSW	8	36104210	missense	probably damaging	1.00
R8152:Prag1	UTSW	8	36099925	missense	possibly damaging	0.53
R8157:Prag1	UTSW	8	36147239	missense	probably damaging	0.99
R8332:Prag1	UTSW	8	36146303	missense	probably damaging	1.00
R8821:Prag1	UTSW	8	36146737	missense	probably benign
R8831:Prag1	UTSW	8	36146737	missense	probably benign
R8927:Prag1	UTSW	8	36147206	missense	probably damaging	1.00
R8928:Prag1	UTSW	8	36147206	missense	probably damaging	1.00
R8973:Prag1	UTSW	8	36099590	start gained	probably benign
Z1177:Prag1	UTSW	8	36147142	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATAGCCAGGGCCAAGTATG -3'
(R):5'- GACAAAAGTTGGGGTCCGAC -3'

Sequencing Primer
(F):5'- GATTCAGAAGACACCCCCT -3'
(R):5'- CGTCGCTGTGGTCAGTCAG -3'

Posted On

2016-12-20