Incidental Mutation 'R5817:Pcsk7'
ID449109
Institutional Source Beutler Lab
Gene Symbol Pcsk7
Ensembl Gene ENSMUSG00000035382
Gene Nameproprotein convertase subtilisin/kexin type 7
SynonymsSPC7
MMRRC Submission 043397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45906497-45929726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45926033 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 552 (M552L)
Ref Sequence ENSEMBL: ENSMUSP00000150393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034590] [ENSMUST00000039059] [ENSMUST00000215189] [ENSMUST00000216672]
Predicted Effect probably benign
Transcript: ENSMUST00000034590
SMART Domains Protein: ENSMUSP00000034590
Gene: ENSMUSG00000032085

DomainStartEndE-ValueType
CH 26 133 1.53e-20 SMART
Pfam:Calponin 175 199 5.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039059
AA Change: M552L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000047508
Gene: ENSMUSG00000035382
AA Change: M552L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:S8_pro-domain 52 140 9.7e-21 PFAM
Pfam:Peptidase_S8 177 464 4.7e-43 PFAM
Pfam:P_proprotein 524 611 1.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214425
Predicted Effect probably benign
Transcript: ENSMUST00000215189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216614
Predicted Effect probably benign
Transcript: ENSMUST00000216672
AA Change: M552L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. It encodes a type 1 membrane bound protease that is expressed in many tissues, including neuroendocrine, liver, gut, and brain. The encoded protein undergoes an initial autocatalytic processing event in the ER and then sorts to the trans-Golgi network through endosomes where a second autocatalytic event takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It can process proalbumin and is thought to be responsible for the activation of HIV envelope glycoproteins gp160 and gp140. This gene has been implicated in the transcriptional regulation of housekeeping genes and plays a role in the regulation of iron metabolism. A t(11;14)(q23;q32) chromosome translocation associated with B-cell lymphoma occurs between this gene and its inverted counterpart. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Pcsk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Pcsk7 APN 9 45927660 missense probably benign
IGL01081:Pcsk7 APN 9 45928707 missense probably benign
IGL02634:Pcsk7 APN 9 45919262 missense possibly damaging 0.87
IGL02999:Pcsk7 APN 9 45927599 missense possibly damaging 0.68
IGL03115:Pcsk7 APN 9 45914372 missense probably damaging 1.00
IGL03149:Pcsk7 APN 9 45909480 missense probably benign 0.37
R0243:Pcsk7 UTSW 9 45916059 missense probably damaging 1.00
R0324:Pcsk7 UTSW 9 45913011 missense possibly damaging 0.87
R0947:Pcsk7 UTSW 9 45911172 missense probably damaging 1.00
R1443:Pcsk7 UTSW 9 45925986 missense probably damaging 1.00
R1545:Pcsk7 UTSW 9 45914348 missense probably damaging 1.00
R2182:Pcsk7 UTSW 9 45928619 missense probably benign
R2939:Pcsk7 UTSW 9 45916024 missense probably damaging 1.00
R3739:Pcsk7 UTSW 9 45926759 missense possibly damaging 0.72
R4039:Pcsk7 UTSW 9 45928007 splice site probably null
R4348:Pcsk7 UTSW 9 45919348 missense probably damaging 1.00
R4974:Pcsk7 UTSW 9 45918862 missense probably damaging 1.00
R6214:Pcsk7 UTSW 9 45910376 missense possibly damaging 0.47
R6215:Pcsk7 UTSW 9 45910376 missense possibly damaging 0.47
R6408:Pcsk7 UTSW 9 45909696 missense probably benign 0.18
R7338:Pcsk7 UTSW 9 45925989 missense probably benign 0.03
R7355:Pcsk7 UTSW 9 45909374 missense probably benign 0.03
R7475:Pcsk7 UTSW 9 45927625 missense probably damaging 1.00
R7540:Pcsk7 UTSW 9 45927673 splice site probably null
R8305:Pcsk7 UTSW 9 45910409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGAGGGCATGTTTATGGGC -3'
(R):5'- GCACTACATTGTTTTCCACAGG -3'

Sequencing Primer
(F):5'- CGGGCTAGTTTCCAACCTG -3'
(R):5'- CTACATTGTTTTCCACAGGATTAGG -3'
Posted On2016-12-20