Incidental Mutation 'R5817:Qars'
ID449110
Institutional Source Beutler Lab
Gene Symbol Qars
Ensembl Gene ENSMUSG00000032604
Gene Nameglutaminyl-tRNA synthetase
Synonyms1110018N24Rik, 1200016L19Rik
MMRRC Submission 043397-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108507706-108515941 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 108510242 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006838] [ENSMUST00000134939] [ENSMUST00000208162] [ENSMUST00000207947] [ENSMUST00000208177] [ENSMUST00000208214] [ENSMUST00000207862] [ENSMUST00000208581] [ENSMUST00000207790] [ENSMUST00000207810] [ENSMUST00000194045]
Predicted Effect probably benign
Transcript: ENSMUST00000006838
SMART Domains Protein: ENSMUSP00000006838
Gene: ENSMUSG00000032604

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 4 162 1.2e-54 PFAM
Pfam:tRNA_synt_1c_R2 165 256 6.5e-31 PFAM
Pfam:tRNA-synt_1c 263 563 4.5e-119 PFAM
Pfam:tRNA-synt_1c_C 565 752 6.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131005
Predicted Effect probably benign
Transcript: ENSMUST00000134939
SMART Domains Protein: ENSMUSP00000122918
Gene: ENSMUSG00000032604

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 1 163 1.1e-55 PFAM
Pfam:tRNA_synt_1c_R2 164 256 6.9e-31 PFAM
Pfam:tRNA-synt_1c 263 563 2.5e-115 PFAM
Pfam:tRNA-synt_1c_C 565 720 5.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141780
Predicted Effect probably benign
Transcript: ENSMUST00000141903
SMART Domains Protein: ENSMUSP00000121146
Gene: ENSMUSG00000032604

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 2 148 2.1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154311
Predicted Effect probably benign
Transcript: ENSMUST00000208162
Predicted Effect probably benign
Transcript: ENSMUST00000207947
Predicted Effect probably benign
Transcript: ENSMUST00000208074
Predicted Effect probably benign
Transcript: ENSMUST00000208177
Predicted Effect probably benign
Transcript: ENSMUST00000207180
Predicted Effect probably benign
Transcript: ENSMUST00000208214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208102
Predicted Effect probably benign
Transcript: ENSMUST00000207713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192659
Predicted Effect probably benign
Transcript: ENSMUST00000207862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207062
Predicted Effect probably benign
Transcript: ENSMUST00000208581
Predicted Effect probably benign
Transcript: ENSMUST00000207734
Predicted Effect probably benign
Transcript: ENSMUST00000207790
Predicted Effect probably benign
Transcript: ENSMUST00000208506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192065
Predicted Effect probably benign
Transcript: ENSMUST00000207810
Predicted Effect probably benign
Transcript: ENSMUST00000194045
Predicted Effect probably benign
Transcript: ENSMUST00000208962
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Qars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Qars APN 9 108511539 missense probably damaging 1.00
IGL02336:Qars APN 9 108514986 nonsense probably null
IGL02393:Qars APN 9 108514329 missense probably benign 0.00
IGL03102:Qars APN 9 108508919 missense probably benign 0.35
R0576:Qars UTSW 9 108514962 intron probably benign
R1777:Qars UTSW 9 108508201 critical splice donor site probably null
R1824:Qars UTSW 9 108514610 missense probably damaging 1.00
R1871:Qars UTSW 9 108514116 splice site probably null
R1897:Qars UTSW 9 108514083 nonsense probably null
R1952:Qars UTSW 9 108513181 missense probably benign 0.35
R1981:Qars UTSW 9 108515028 missense probably damaging 1.00
R2172:Qars UTSW 9 108509200 missense probably damaging 1.00
R2698:Qars UTSW 9 108508443 missense possibly damaging 0.65
R4381:Qars UTSW 9 108510183 unclassified probably benign
R4608:Qars UTSW 9 108509426 splice site probably null
R4677:Qars UTSW 9 108509690 unclassified probably benign
R4974:Qars UTSW 9 108508931 missense probably damaging 1.00
R5234:Qars UTSW 9 108514165 missense probably damaging 1.00
R5548:Qars UTSW 9 108512918 missense possibly damaging 0.72
R6029:Qars UTSW 9 108513690 missense probably damaging 1.00
R6110:Qars UTSW 9 108508098 missense probably benign 0.02
R6889:Qars UTSW 9 108513183 missense probably damaging 0.98
R7034:Qars UTSW 9 108514777 missense probably damaging 1.00
R7036:Qars UTSW 9 108514777 missense probably damaging 1.00
R7136:Qars UTSW 9 108512772 missense probably damaging 1.00
R7178:Qars UTSW 9 108515123 missense possibly damaging 0.50
R7192:Qars UTSW 9 108511561 missense probably damaging 1.00
R7235:Qars UTSW 9 108510132 missense probably damaging 1.00
R7813:Qars UTSW 9 108509471 missense probably damaging 1.00
R8248:Qars UTSW 9 108509452 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGAGAGAGTACACCCTTGTCTG -3'
(R):5'- TCGCAGTCATGAGAATACGG -3'

Sequencing Primer
(F):5'- AGAGTACACCCTTGTCTGTATCTATC -3'
(R):5'- CCCGAGAAGTCTGTATGTAAGGTCC -3'
Posted On2016-12-20