Incidental Mutation 'R5817:Fam20a'
ID449115
Institutional Source Beutler Lab
Gene Symbol Fam20a
Ensembl Gene ENSMUSG00000020614
Gene Namefamily with sequence similarity 20, member A
Synonyms
MMRRC Submission 043397-MU
Accession Numbers

Ncbi RefSeq: NM_153782.1; MGI:2388266

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109669749-109722279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109673418 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 503 (Q503L)
Ref Sequence ENSEMBL: ENSMUSP00000116687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020938] [ENSMUST00000049527] [ENSMUST00000106677] [ENSMUST00000155559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020938
AA Change: Q503L

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020938
Gene: ENSMUSG00000020614
AA Change: Q503L

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:Fam20C 306 522 8.9e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049527
SMART Domains Protein: ENSMUSP00000056500
Gene: ENSMUSG00000020612

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
RIIa 25 62 7.54e-15 SMART
cNMP 137 253 2.99e-32 SMART
cNMP 255 374 1.74e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106677
SMART Domains Protein: ENSMUSP00000102288
Gene: ENSMUSG00000020612

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
RIIa 25 62 7.54e-15 SMART
cNMP 137 253 2.99e-32 SMART
cNMP 255 374 1.74e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146408
Predicted Effect possibly damaging
Transcript: ENSMUST00000155559
AA Change: Q503L

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116687
Gene: ENSMUSG00000020614
AA Change: Q503L

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:DUF1193 305 525 3.2e-103 PFAM
Meta Mutation Damage Score 0.0926 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
MGI Phenotype Strain: 5432376
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that is likely secreted and may function in hematopoiesis. A mutation at this locus has been associated with amelogenesis imperfecta and gingival hyperplasia syndrome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ameloblast morphology, disrupted dental enamel formation in both incisor and molar teeth, abnormal kidney morphology, disseminated calcifications of muscular arteries, and intrapulmonary calcifications. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Fam20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Fam20a APN 11 109677762 splice site probably benign
IGL01296:Fam20a APN 11 109685351 missense possibly damaging 0.93
IGL01319:Fam20a APN 11 109678458 splice site probably benign
IGL01322:Fam20a APN 11 109682912 missense probably damaging 1.00
IGL02086:Fam20a APN 11 109673413 missense probably benign 0.00
IGL02563:Fam20a APN 11 109677794 missense possibly damaging 0.53
IGL02883:Fam20a APN 11 109675127 missense probably damaging 0.99
IGL02893:Fam20a APN 11 109721588 missense probably benign 0.00
ungainly UTSW 11 109682870 nonsense probably null
P0026:Fam20a UTSW 11 109675841 critical splice donor site probably null
R0726:Fam20a UTSW 11 109677194 missense probably damaging 1.00
R1317:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1462:Fam20a UTSW 11 109677317 missense probably damaging 1.00
R1462:Fam20a UTSW 11 109677317 missense probably damaging 1.00
R1751:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1761:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1889:Fam20a UTSW 11 109673554 missense probably benign 0.30
R1895:Fam20a UTSW 11 109673554 missense probably benign 0.30
R1971:Fam20a UTSW 11 109685411 missense probably damaging 1.00
R2192:Fam20a UTSW 11 109674623 missense probably benign 0.13
R3745:Fam20a UTSW 11 109677790 missense probably benign 0.17
R4684:Fam20a UTSW 11 109721687 missense unknown
R4835:Fam20a UTSW 11 109673563 missense probably benign 0.40
R5045:Fam20a UTSW 11 109677885 missense probably benign 0.38
R5161:Fam20a UTSW 11 109673370 missense probably benign 0.00
R5715:Fam20a UTSW 11 109678431 missense probably damaging 1.00
R5960:Fam20a UTSW 11 109675969 intron probably benign
R6162:Fam20a UTSW 11 109682870 nonsense probably null
R6312:Fam20a UTSW 11 109674630 missense probably damaging 1.00
R7231:Fam20a UTSW 11 109721375 missense possibly damaging 0.92
R7311:Fam20a UTSW 11 109674628 nonsense probably null
R7366:Fam20a UTSW 11 109673342 missense possibly damaging 0.87
R8013:Fam20a UTSW 11 109685506 missense possibly damaging 0.92
R8014:Fam20a UTSW 11 109685506 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGAGGTGCTGACTCCAGTTG -3'
(R):5'- TGCCAAGAGCTGTTAGTGG -3'

Sequencing Primer
(F):5'- GTGTGTTCTGAGGTCCCAC -3'
(R):5'- CAAGTGCAGGCTGAGTTACCTTC -3'
Posted On2016-12-20