Mutagenetix > Incidental Mutations

Incidental Mutation 'R5817:Ahnak2'

449120

Institutional Source

Beutler Lab

Gene Symbol

Ahnak2

Ensembl Gene

ENSMUSG00000072812

Gene Name

AHNAK nucleoprotein 2

Synonyms

LOC382643

MMRRC Submission

043397-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R5817 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112772194-112802657 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 112774003 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 406 (F406I)

Ref Sequence

ENSEMBL: ENSMUSP00000098572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101010] [ENSMUST00000128258]

Predicted Effect

probably damaging
Transcript: ENSMUST00000101010
AA Change: F406I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098572
Gene: ENSMUSG00000072812
AA Change: F406I

Domain	Start	End	E-Value	Type
low complexity region	5	14	N/A	INTRINSIC
low complexity region	364	375	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	717	733	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128258
AA Change: F1212I

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812
AA Change: F1212I

Domain	Start	End	E-Value	Type
low complexity region	5	66	N/A	INTRINSIC
internal_repeat_1	67	251	2.35e-83	PROSPERO
low complexity region	285	308	N/A	INTRINSIC
low complexity region	371	389	N/A	INTRINSIC
internal_repeat_1	413	597	2.35e-83	PROSPERO
low complexity region	734	756	N/A	INTRINSIC
low complexity region	811	820	N/A	INTRINSIC
low complexity region	1170	1181	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1523	1539	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137195

SMART Domains

Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812

Domain	Start	End	E-Value	Type
internal_repeat_1	2	521	3.81e-221	PROSPERO
low complexity region	557	569	N/A	INTRINSIC
internal_repeat_1	606	1126	3.81e-221	PROSPERO

Meta Mutation Damage Score

0.15

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (71/71)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	A	G	4: 144,622,927	I251M	probably benign	Het
Abcf3	T	C	16: 20,549,083	V63A	possibly damaging	Het
Agpat4	C	T	17: 12,215,210		probably benign	Het
Ahcyl2	G	A	6: 29,890,721	V292M	probably damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arhgef5	G	A	6: 43,275,104	D930N	probably benign	Het
Casc4	T	A	2: 121,906,044	S231T	probably benign	Het
Cc2d2a	G	A	5: 43,712,418	R887Q	probably damaging	Het
Ceacam18	A	G	7: 43,641,841	T236A	probably benign	Het
Chst15	A	T	7: 132,269,144	Y221N	probably damaging	Het
Chst15	G	A	7: 132,269,147	L220F	probably damaging	Het
Cntn2	G	A	1: 132,518,748	T784I	probably benign	Het
D630003M21Rik	A	G	2: 158,196,493	L1011P	probably damaging	Het
Dync2h1	T	A	9: 6,996,905	D3894V	probably damaging	Het
E330017A01Rik	T	C	16: 58,636,793	I89V	probably benign	Het
Fam13b	T	C	18: 34,457,797	M443V	possibly damaging	Het
Fam20a	T	A	11: 109,673,418	Q503L	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm21319	G	T	12: 87,773,431	D119E	probably benign	Het
Gm5454	T	A	13: 103,356,632		noncoding transcript	Het
Gm5581	A	G	6: 131,167,169		noncoding transcript	Het
Gm6619	A	G	6: 131,486,437	I6V	unknown	Het
Gmcl1	A	G	6: 86,714,248	M255T	probably damaging	Het
Gprc5c	T	A	11: 114,863,624	C42*	probably null	Het
Hmcn1	T	A	1: 150,737,524	E1384V	possibly damaging	Het
Il6	A	G	5: 30,018,008	I91V	probably benign	Het
Kmt2d	A	T	15: 98,862,363	S1005T	unknown	Het
Map1a	A	T	2: 121,298,910	H143L	possibly damaging	Het
Mical2	A	T	7: 112,323,659	T624S	probably benign	Het
Msh3	A	T	13: 92,286,000	N549K	possibly damaging	Het
Ncr1	T	A	7: 4,340,895	I164N	possibly damaging	Het
Olfr1333	T	G	4: 118,830,099	T115P	probably damaging	Het
Olfr554	A	G	7: 102,640,378	N44S	probably damaging	Het
Olfr586	A	T	7: 103,121,908	M292K	possibly damaging	Het
Olfr926	A	G	9: 38,877,377	D67G	probably damaging	Het
Palmd	T	C	3: 116,918,623	I541M	probably benign	Het
Pcsk7	A	T	9: 45,926,033	M552L	probably benign	Het
Plekhh2	A	G	17: 84,571,726	E626G	possibly damaging	Het
Pole	G	A	5: 110,312,972	D1176N	probably damaging	Het
Polr2f	T	C	15: 79,151,669	I110T	probably damaging	Het
Pomt1	A	T	2: 32,248,679	I436F	probably damaging	Het
Prag1	A	C	8: 36,103,703	Q480P	probably damaging	Het
Qars	C	T	9: 108,510,242		probably benign	Het
Ralgapa2	G	A	2: 146,333,486	S1797L	probably damaging	Het
Rbm26	T	C	14: 105,128,603	T832A	probably damaging	Het
Rnf169	A	G	7: 99,925,769	S540P	probably benign	Het
Serpini1	T	A	3: 75,613,324	M76K	probably benign	Het
Shq1	A	G	6: 100,573,720	L419S	probably damaging	Het
Slc25a17	G	A	15: 81,327,060	T225M	probably damaging	Het
Slc6a5	C	A	7: 49,956,491	L716I	probably benign	Het
Smc1b	A	G	15: 85,067,783	V1149A	probably damaging	Het
Trappc1	A	T	11: 69,324,234	Q26L	possibly damaging	Het
Trpm2	C	A	10: 77,965,980	G84W	probably damaging	Het
Ttn	G	A	2: 76,742,666	T24215M	probably damaging	Het
Ubn2	C	A	6: 38,479,153	T337K	probably damaging	Het
Ubr4	A	G	4: 139,468,847	K1265E	probably damaging	Het
Vmn1r214	T	G	13: 23,035,321	I328M	probably damaging	Het
Xcr1	C	T	9: 123,855,857	C280Y	possibly damaging	Het
Zc3h13	A	G	14: 75,328,132	E895G	probably damaging	Het

Other mutations in Ahnak2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02257:Ahnak2	APN	12	112785285	missense	possibly damaging	0.79
IGL02994:Ahnak2	APN	12	112786207	missense	probably damaging	0.99
PIT4480001:Ahnak2	UTSW	12	112773924	missense	possibly damaging	0.79
PIT4810001:Ahnak2	UTSW	12	112785594	missense
R0025:Ahnak2	UTSW	12	112785534	missense	probably damaging	0.99
R0025:Ahnak2	UTSW	12	112785534	missense	probably damaging	0.99
R0038:Ahnak2	UTSW	12	112774462	missense	probably benign	0.00
R0125:Ahnak2	UTSW	12	112785156	missense	probably benign	0.41
R1173:Ahnak2	UTSW	12	112785789	missense	probably damaging	1.00
R1494:Ahnak2	UTSW	12	112787950	missense	probably damaging	1.00
R1712:Ahnak2	UTSW	12	112785378	missense	probably benign	0.05
R1888:Ahnak2	UTSW	12	112773891	missense	possibly damaging	0.49
R1888:Ahnak2	UTSW	12	112773891	missense	possibly damaging	0.49
R2042:Ahnak2	UTSW	12	112785819	missense	probably damaging	0.98
R2056:Ahnak2	UTSW	12	112785006	missense	probably benign	0.00
R2417:Ahnak2	UTSW	12	112775371	missense	probably damaging	1.00
R2762:Ahnak2	UTSW	12	112785364	missense	probably damaging	0.96
R3618:Ahnak2	UTSW	12	112786222	missense	probably damaging	1.00
R3706:Ahnak2	UTSW	12	112773651	missense	possibly damaging	0.74
R3739:Ahnak2	UTSW	12	112774558	missense	probably benign	0.05
R3950:Ahnak2	UTSW	12	112785789	missense	probably damaging	1.00
R4485:Ahnak2	UTSW	12	112779767	unclassified	probably benign
R4651:Ahnak2	UTSW	12	112774837	missense	possibly damaging	0.93
R4652:Ahnak2	UTSW	12	112774837	missense	possibly damaging	0.93
R4831:Ahnak2	UTSW	12	112775749	missense	probably damaging	0.99
R4836:Ahnak2	UTSW	12	112774116	missense	probably damaging	1.00
R4837:Ahnak2	UTSW	12	112785739	missense	probably benign	0.00
R4864:Ahnak2	UTSW	12	112773606	missense	probably damaging	0.98
R4908:Ahnak2	UTSW	12	112775272	missense	probably benign	0.00
R5067:Ahnak2	UTSW	12	112785316	missense	probably benign	0.01
R5146:Ahnak2	UTSW	12	112775726	missense	probably benign	0.00
R5228:Ahnak2	UTSW	12	112775386	missense	probably benign	0.03
R5255:Ahnak2	UTSW	12	112773378	missense	possibly damaging	0.92
R5323:Ahnak2	UTSW	12	112779812	unclassified	probably benign
R5523:Ahnak2	UTSW	12	112775208	missense	probably damaging	1.00
R5733:Ahnak2	UTSW	12	112775666	nonsense	probably null
R5799:Ahnak2	UTSW	12	112778930	unclassified	probably benign
R5835:Ahnak2	UTSW	12	112775796	missense	possibly damaging	0.66
R6083:Ahnak2	UTSW	12	112782612	missense	probably benign	0.06
R6083:Ahnak2	UTSW	12	112782999	missense	probably benign	0.01
R6167:Ahnak2	UTSW	12	112783122	missense	probably benign	0.03
R6168:Ahnak2	UTSW	12	112783122	missense	probably benign	0.03
R6405:Ahnak2	UTSW	12	112773337	missense	probably damaging	1.00
R6460:Ahnak2	UTSW	12	112786990	missense	probably null	0.27
R6495:Ahnak2	UTSW	12	112773714	missense	probably damaging	1.00
R6544:Ahnak2	UTSW	12	112780652	unclassified	probably benign
R6656:Ahnak2	UTSW	12	112785371	missense	probably benign	0.02
R6679:Ahnak2	UTSW	12	112772976	missense	probably damaging	1.00
R6723:Ahnak2	UTSW	12	112778793	missense	probably damaging	1.00
R6774:Ahnak2	UTSW	12	112773738	missense	possibly damaging	0.87
R6884:Ahnak2	UTSW	12	112775429	missense	possibly damaging	0.81
R6906:Ahnak2	UTSW	12	112785313	missense	probably benign	0.00
R6919:Ahnak2	UTSW	12	112774684	missense	possibly damaging	0.55
R7036:Ahnak2	UTSW	12	112778781	unclassified	probably benign
R7037:Ahnak2	UTSW	12	112774278	missense	probably damaging	0.99
R7064:Ahnak2	UTSW	12	112780742	unclassified	probably benign
R7072:Ahnak2	UTSW	12	112788166	missense
R7112:Ahnak2	UTSW	12	112783119	missense
R7268:Ahnak2	UTSW	12	112780802	missense
R7269:Ahnak2	UTSW	12	112780802	missense
R7270:Ahnak2	UTSW	12	112780802	missense
R7271:Ahnak2	UTSW	12	112780802	missense
R7444:Ahnak2	UTSW	12	112781208	missense
R7448:Ahnak2	UTSW	12	112782502	missense
R7488:Ahnak2	UTSW	12	112785021	missense
R7508:Ahnak2	UTSW	12	112774405	missense	possibly damaging	0.46
R7560:Ahnak2	UTSW	12	112779674	missense

Predicted Primers

PCR Primer
(F):5'- AGACCCCTGAATGTGCACTC -3'
(R):5'- GGAAATATCCCTGCTGAGATGG -3'

Sequencing Primer
(F):5'- GCACTCTGACCTTAGAAATTGGG -3'
(R):5'- TATCCCTGCTGAGATGGAGGCTAG -3'

Posted On

2016-12-20