Mutagenetix > Incidental Mutations

Incidental Mutation 'R5817:Zc3h13'

449125

Institutional Source

Beutler Lab

Gene Symbol

Zc3h13

Ensembl Gene

ENSMUSG00000022000

Gene Name

zinc finger CCCH type containing 13

Synonyms

4930570G11Rik, 3110050K21Rik, 2600010B19Rik, C87618

MMRRC Submission

043397-MU

Accession Numbers

Genbank: NM_026083

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R5817 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75284373-75344426 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75328132 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 895 (E895G)

Ref Sequence

ENSEMBL: ENSMUSP00000022577 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]

AlphaFold

E9Q784

Predicted Effect

probably damaging
Transcript: ENSMUST00000022577
AA Change: E895G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000
AA Change: E895G

Domain	Start	End	E-Value	Type
ZnF_C3H1	36	63	4.54e-4	SMART
low complexity region	136	145	N/A	INTRINSIC
coiled coil region	162	197	N/A	INTRINSIC
low complexity region	204	233	N/A	INTRINSIC
low complexity region	261	269	N/A	INTRINSIC
low complexity region	278	287	N/A	INTRINSIC
low complexity region	321	357	N/A	INTRINSIC
low complexity region	411	478	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	496	575	N/A	INTRINSIC
low complexity region	684	701	N/A	INTRINSIC
coiled coil region	706	865	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
internal_repeat_1	921	948	1.8e-6	PROSPERO
low complexity region	964	985	N/A	INTRINSIC
low complexity region	1032	1052	N/A	INTRINSIC
low complexity region	1071	1087	N/A	INTRINSIC
low complexity region	1160	1218	N/A	INTRINSIC
low complexity region	1253	1265	N/A	INTRINSIC
internal_repeat_1	1273	1301	1.8e-6	PROSPERO
low complexity region	1325	1349	N/A	INTRINSIC
low complexity region	1366	1391	N/A	INTRINSIC
low complexity region	1400	1425	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
low complexity region	1690	1697	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000227049
AA Change: E895G

Meta Mutation Damage Score

0.1541

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (71/71)

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	A	G	4: 144,622,927	I251M	probably benign	Het
Abcf3	T	C	16: 20,549,083	V63A	possibly damaging	Het
Agpat4	C	T	17: 12,215,210		probably benign	Het
Ahcyl2	G	A	6: 29,890,721	V292M	probably damaging	Het
Ahnak2	A	T	12: 112,774,003	F406I	probably damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arhgef5	G	A	6: 43,275,104	D930N	probably benign	Het
Casc4	T	A	2: 121,906,044	S231T	probably benign	Het
Cc2d2a	G	A	5: 43,712,418	R887Q	probably damaging	Het
Ceacam18	A	G	7: 43,641,841	T236A	probably benign	Het
Chst15	A	T	7: 132,269,144	Y221N	probably damaging	Het
Chst15	G	A	7: 132,269,147	L220F	probably damaging	Het
Cntn2	G	A	1: 132,518,748	T784I	probably benign	Het
D630003M21Rik	A	G	2: 158,196,493	L1011P	probably damaging	Het
Dync2h1	T	A	9: 6,996,905	D3894V	probably damaging	Het
E330017A01Rik	T	C	16: 58,636,793	I89V	probably benign	Het
Fam13b	T	C	18: 34,457,797	M443V	possibly damaging	Het
Fam20a	T	A	11: 109,673,418	Q503L	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm21319	G	T	12: 87,773,431	D119E	probably benign	Het
Gm5454	T	A	13: 103,356,632		noncoding transcript	Het
Gm5581	A	G	6: 131,167,169		noncoding transcript	Het
Gm6619	A	G	6: 131,486,437	I6V	unknown	Het
Gmcl1	A	G	6: 86,714,248	M255T	probably damaging	Het
Gprc5c	T	A	11: 114,863,624	C42*	probably null	Het
Hmcn1	T	A	1: 150,737,524	E1384V	possibly damaging	Het
Il6	A	G	5: 30,018,008	I91V	probably benign	Het
Kmt2d	A	T	15: 98,862,363	S1005T	unknown	Het
Map1a	A	T	2: 121,298,910	H143L	possibly damaging	Het
Mical2	A	T	7: 112,323,659	T624S	probably benign	Het
Msh3	A	T	13: 92,286,000	N549K	possibly damaging	Het
Ncr1	T	A	7: 4,340,895	I164N	possibly damaging	Het
Olfr1333	T	G	4: 118,830,099	T115P	probably damaging	Het
Olfr554	A	G	7: 102,640,378	N44S	probably damaging	Het
Olfr586	A	T	7: 103,121,908	M292K	possibly damaging	Het
Olfr926	A	G	9: 38,877,377	D67G	probably damaging	Het
Palmd	T	C	3: 116,918,623	I541M	probably benign	Het
Pcsk7	A	T	9: 45,926,033	M552L	probably benign	Het
Plekhh2	A	G	17: 84,571,726	E626G	possibly damaging	Het
Pole	G	A	5: 110,312,972	D1176N	probably damaging	Het
Polr2f	T	C	15: 79,151,669	I110T	probably damaging	Het
Pomt1	A	T	2: 32,248,679	I436F	probably damaging	Het
Prag1	A	C	8: 36,103,703	Q480P	probably damaging	Het
Qars	C	T	9: 108,510,242		probably benign	Het
Ralgapa2	G	A	2: 146,333,486	S1797L	probably damaging	Het
Rbm26	T	C	14: 105,128,603	T832A	probably damaging	Het
Rnf169	A	G	7: 99,925,769	S540P	probably benign	Het
Serpini1	T	A	3: 75,613,324	M76K	probably benign	Het
Shq1	A	G	6: 100,573,720	L419S	probably damaging	Het
Slc25a17	G	A	15: 81,327,060	T225M	probably damaging	Het
Slc6a5	C	A	7: 49,956,491	L716I	probably benign	Het
Smc1b	A	G	15: 85,067,783	V1149A	probably damaging	Het
Trappc1	A	T	11: 69,324,234	Q26L	possibly damaging	Het
Trpm2	C	A	10: 77,965,980	G84W	probably damaging	Het
Ttn	G	A	2: 76,742,666	T24215M	probably damaging	Het
Ubn2	C	A	6: 38,479,153	T337K	probably damaging	Het
Ubr4	A	G	4: 139,468,847	K1265E	probably damaging	Het
Vmn1r214	T	G	13: 23,035,321	I328M	probably damaging	Het
Xcr1	C	T	9: 123,855,857	C280Y	possibly damaging	Het

Other mutations in Zc3h13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00945:Zc3h13	APN	14	75330147	missense	probably damaging	0.99
IGL01129:Zc3h13	APN	14	75335999	missense	probably damaging	1.00
IGL01599:Zc3h13	APN	14	75309723	missense	probably damaging	1.00
IGL01844:Zc3h13	APN	14	75343769	utr 3 prime	probably benign
IGL02132:Zc3h13	APN	14	75330347	missense	probably benign	0.10
IGL03108:Zc3h13	APN	14	75331766	missense	possibly damaging	0.73
IGL03299:Zc3h13	APN	14	75293941	missense	probably damaging	1.00
IGL03377:Zc3h13	APN	14	75293976	missense	possibly damaging	0.53
B5639:Zc3h13	UTSW	14	75316039	missense	probably damaging	1.00
FR4304:Zc3h13	UTSW	14	75323603	small insertion	probably benign
FR4304:Zc3h13	UTSW	14	75323610	small insertion	probably benign
FR4340:Zc3h13	UTSW	14	75323592	small insertion	probably benign
FR4449:Zc3h13	UTSW	14	75323601	nonsense	probably null
FR4548:Zc3h13	UTSW	14	75323599	small insertion	probably benign
FR4589:Zc3h13	UTSW	14	75323592	small insertion	probably benign
FR4589:Zc3h13	UTSW	14	75323597	small insertion	probably benign
FR4589:Zc3h13	UTSW	14	75323598	small insertion	probably benign
FR4737:Zc3h13	UTSW	14	75323596	small insertion	probably benign
FR4737:Zc3h13	UTSW	14	75323599	small insertion	probably benign
PIT4696001:Zc3h13	UTSW	14	75331883	missense	probably damaging	1.00
R0103:Zc3h13	UTSW	14	75330468	missense	probably damaging	0.98
R0103:Zc3h13	UTSW	14	75330468	missense	probably damaging	0.98
R0127:Zc3h13	UTSW	14	75323254	missense	unknown
R0374:Zc3h13	UTSW	14	75308965	missense	probably damaging	1.00
R0396:Zc3h13	UTSW	14	75323482	missense	unknown
R0408:Zc3h13	UTSW	14	75292186	nonsense	probably null
R0967:Zc3h13	UTSW	14	75343739	missense	possibly damaging	0.54
R1006:Zc3h13	UTSW	14	75330549	missense	probably damaging	0.99
R1142:Zc3h13	UTSW	14	75315984	missense	probably benign	0.14
R1605:Zc3h13	UTSW	14	75337483	nonsense	probably null
R2021:Zc3h13	UTSW	14	75330195	missense	probably damaging	0.96
R2270:Zc3h13	UTSW	14	75332147	missense	probably benign	0.03
R3508:Zc3h13	UTSW	14	75308940	nonsense	probably null
R3745:Zc3h13	UTSW	14	75330661	missense	probably benign	0.03
R3954:Zc3h13	UTSW	14	75329738	missense	possibly damaging	0.85
R4205:Zc3h13	UTSW	14	75327601	missense	unknown
R4799:Zc3h13	UTSW	14	75339423	missense	probably damaging	1.00
R5042:Zc3h13	UTSW	14	75339396	missense	probably damaging	0.98
R5133:Zc3h13	UTSW	14	75336009	missense	probably damaging	1.00
R5384:Zc3h13	UTSW	14	75343619	missense	probably benign	0.14
R5432:Zc3h13	UTSW	14	75331247	missense	probably damaging	1.00
R5611:Zc3h13	UTSW	14	75330908	missense	probably benign	0.10
R5687:Zc3h13	UTSW	14	75331960	nonsense	probably null
R5726:Zc3h13	UTSW	14	75330829	missense	possibly damaging	0.84
R6087:Zc3h13	UTSW	14	75330709	missense	probably damaging	0.96
R6224:Zc3h13	UTSW	14	75337409	missense	probably damaging	0.99
R6247:Zc3h13	UTSW	14	75343736	missense	probably benign	0.14
R6278:Zc3h13	UTSW	14	75330423	missense	probably benign	0.01
R6315:Zc3h13	UTSW	14	75308915	missense	probably damaging	1.00
R6490:Zc3h13	UTSW	14	75323558	small deletion	probably benign
R6598:Zc3h13	UTSW	14	75332183	missense	probably damaging	0.99
R7051:Zc3h13	UTSW	14	75331157	missense	probably damaging	1.00
R7054:Zc3h13	UTSW	14	75321787	missense	probably benign	0.19
R7135:Zc3h13	UTSW	14	75321721	missense	unknown
R7307:Zc3h13	UTSW	14	75330541	missense	probably damaging	0.96
R7515:Zc3h13	UTSW	14	75308909	missense	unknown
R7680:Zc3h13	UTSW	14	75330515	missense	probably damaging	0.99
R8031:Zc3h13	UTSW	14	75330630	missense	not run
R8048:Zc3h13	UTSW	14	75324537	missense	unknown
R8059:Zc3h13	UTSW	14	75327810	missense	unknown
R8362:Zc3h13	UTSW	14	75324469	missense	unknown
R8391:Zc3h13	UTSW	14	75331185	missense	probably damaging	1.00
R8724:Zc3h13	UTSW	14	75332072	missense	probably benign	0.05
R9081:Zc3h13	UTSW	14	75331941	small deletion	probably benign
R9082:Zc3h13	UTSW	14	75331941	small deletion	probably benign
R9101:Zc3h13	UTSW	14	75323602	missense	unknown
R9214:Zc3h13	UTSW	14	75323551	missense	unknown
R9308:Zc3h13	UTSW	14	75327978	missense	unknown
R9376:Zc3h13	UTSW	14	75323688	missense	unknown
Z1177:Zc3h13	UTSW	14	75328065	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCAAGCTCACCTATTCGCCATC -3'
(R):5'- TCTGAGGTTTGCATTCATTATTCTTT -3'

Sequencing Primer
(F):5'- TCAGCGAGATCGTGACCATG -3'
(R):5'- CCATCAGTGCTGGGATTAAAACCATG -3'

Posted On

2016-12-20