Incidental Mutation 'R5817:Zc3h13'
ID449125
Institutional Source Beutler Lab
Gene Symbol Zc3h13
Ensembl Gene ENSMUSG00000022000
Gene Namezinc finger CCCH type containing 13
Synonyms4930570G11Rik, 3110050K21Rik, 2600010B19Rik, C87618
MMRRC Submission 043397-MU
Accession Numbers

Genbank: NM_026083

Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75284373-75344426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75328132 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 895 (E895G)
Ref Sequence ENSEMBL: ENSMUSP00000022577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]
Predicted Effect probably damaging
Transcript: ENSMUST00000022577
AA Change: E895G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000
AA Change: E895G

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000227049
AA Change: E895G
Meta Mutation Damage Score 0.1541 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9) 

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Other mutations in Zc3h13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Zc3h13 APN 14 75330147 missense probably damaging 0.99
IGL01129:Zc3h13 APN 14 75335999 missense probably damaging 1.00
IGL01599:Zc3h13 APN 14 75309723 missense probably damaging 1.00
IGL01844:Zc3h13 APN 14 75343769 utr 3 prime probably benign
IGL02132:Zc3h13 APN 14 75330347 missense probably benign 0.10
IGL03108:Zc3h13 APN 14 75331766 missense possibly damaging 0.73
IGL03299:Zc3h13 APN 14 75293941 missense probably damaging 1.00
IGL03377:Zc3h13 APN 14 75293976 missense possibly damaging 0.53
B5639:Zc3h13 UTSW 14 75316039 missense probably damaging 1.00
FR4304:Zc3h13 UTSW 14 75323603 small insertion probably benign
FR4304:Zc3h13 UTSW 14 75323610 small insertion probably benign
FR4340:Zc3h13 UTSW 14 75323592 small insertion probably benign
FR4449:Zc3h13 UTSW 14 75323601 nonsense probably null
FR4548:Zc3h13 UTSW 14 75323599 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323592 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323597 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323598 small insertion probably benign
FR4737:Zc3h13 UTSW 14 75323596 small insertion probably benign
FR4737:Zc3h13 UTSW 14 75323599 small insertion probably benign
PIT4696001:Zc3h13 UTSW 14 75331883 missense probably damaging 1.00
R0103:Zc3h13 UTSW 14 75330468 missense probably damaging 0.98
R0103:Zc3h13 UTSW 14 75330468 missense probably damaging 0.98
R0127:Zc3h13 UTSW 14 75323254 missense unknown
R0374:Zc3h13 UTSW 14 75308965 missense probably damaging 1.00
R0396:Zc3h13 UTSW 14 75323482 missense unknown
R0408:Zc3h13 UTSW 14 75292186 nonsense probably null
R0967:Zc3h13 UTSW 14 75343739 missense possibly damaging 0.54
R1006:Zc3h13 UTSW 14 75330549 missense probably damaging 0.99
R1142:Zc3h13 UTSW 14 75315984 missense probably benign 0.14
R1605:Zc3h13 UTSW 14 75337483 nonsense probably null
R2021:Zc3h13 UTSW 14 75330195 missense probably damaging 0.96
R2270:Zc3h13 UTSW 14 75332147 missense probably benign 0.03
R3508:Zc3h13 UTSW 14 75308940 nonsense probably null
R3745:Zc3h13 UTSW 14 75330661 missense probably benign 0.03
R3954:Zc3h13 UTSW 14 75329738 missense possibly damaging 0.85
R4205:Zc3h13 UTSW 14 75327601 missense unknown
R4799:Zc3h13 UTSW 14 75339423 missense probably damaging 1.00
R5042:Zc3h13 UTSW 14 75339396 missense probably damaging 0.98
R5133:Zc3h13 UTSW 14 75336009 missense probably damaging 1.00
R5384:Zc3h13 UTSW 14 75343619 missense probably benign 0.14
R5432:Zc3h13 UTSW 14 75331247 missense probably damaging 1.00
R5611:Zc3h13 UTSW 14 75330908 missense probably benign 0.10
R5687:Zc3h13 UTSW 14 75331960 nonsense probably null
R5726:Zc3h13 UTSW 14 75330829 missense possibly damaging 0.84
R6087:Zc3h13 UTSW 14 75330709 missense probably damaging 0.96
R6224:Zc3h13 UTSW 14 75337409 missense probably damaging 0.99
R6247:Zc3h13 UTSW 14 75343736 missense probably benign 0.14
R6278:Zc3h13 UTSW 14 75330423 missense probably benign 0.01
R6315:Zc3h13 UTSW 14 75308915 missense probably damaging 1.00
R6490:Zc3h13 UTSW 14 75323558 small deletion probably benign
R6598:Zc3h13 UTSW 14 75332183 missense probably damaging 0.99
R7051:Zc3h13 UTSW 14 75331157 missense probably damaging 1.00
R7054:Zc3h13 UTSW 14 75321787 missense probably benign 0.19
R7135:Zc3h13 UTSW 14 75321721 missense unknown
R7307:Zc3h13 UTSW 14 75330541 missense probably damaging 0.96
R7515:Zc3h13 UTSW 14 75308909 missense unknown
R7680:Zc3h13 UTSW 14 75330515 missense probably damaging 0.99
R8031:Zc3h13 UTSW 14 75330630 missense not run
R8048:Zc3h13 UTSW 14 75324537 missense unknown
R8059:Zc3h13 UTSW 14 75327810 missense unknown
R8362:Zc3h13 UTSW 14 75324469 missense unknown
R8391:Zc3h13 UTSW 14 75331185 missense probably damaging 1.00
Z1177:Zc3h13 UTSW 14 75328065 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAAGCTCACCTATTCGCCATC -3'
(R):5'- TCTGAGGTTTGCATTCATTATTCTTT -3'

Sequencing Primer
(F):5'- TCAGCGAGATCGTGACCATG -3'
(R):5'- CCATCAGTGCTGGGATTAAAACCATG -3'
Posted On2016-12-20