Incidental Mutation 'R5817:Polr2f'
ID449127
Institutional Source Beutler Lab
Gene Symbol Polr2f
Ensembl Gene ENSMUSG00000033020
Gene Namepolymerase (RNA) II (DNA directed) polypeptide F
SynonymsRNA Pol II, 1810060D16Rik
MMRRC Submission 043397-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79141009-79151774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79151669 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 110 (I110T)
Ref Sequence ENSEMBL: ENSMUSP00000043566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040019] [ENSMUST00000040077] [ENSMUST00000229973] [ENSMUST00000230261] [ENSMUST00000230271] [ENSMUST00000230532]
Predicted Effect probably benign
Transcript: ENSMUST00000040019
SMART Domains Protein: ENSMUSP00000039466
Gene: ENSMUSG00000033006

DomainStartEndE-ValueType
Pfam:Sox_N 12 93 1.8e-31 PFAM
HMG 103 173 8.16e-27 SMART
low complexity region 183 205 N/A INTRINSIC
low complexity region 238 245 N/A INTRINSIC
low complexity region 310 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000040077
AA Change: I110T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043566
Gene: ENSMUSG00000033020
AA Change: I110T

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
Pfam:RNA_pol_Rpb6 51 104 2.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229762
Predicted Effect probably benign
Transcript: ENSMUST00000229973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229978
Predicted Effect probably benign
Transcript: ENSMUST00000230261
Predicted Effect possibly damaging
Transcript: ENSMUST00000230271
AA Change: I125T

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000230532
Meta Mutation Damage Score 0.2748 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the sixth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. In yeast, this polymerase subunit, in combination with at least two other subunits, forms a structure that stabilizes the transcribing polymerase on the DNA template. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Polr2f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Polr2f APN 15 79146129 missense probably damaging 1.00
R1727:Polr2f UTSW 15 79144605 unclassified probably benign
R3120:Polr2f UTSW 15 79144588 splice site probably null
R4724:Polr2f UTSW 15 79146069 missense probably benign 0.01
R5050:Polr2f UTSW 15 79144662 unclassified probably benign
R5139:Polr2f UTSW 15 79151658 missense possibly damaging 0.53
R5768:Polr2f UTSW 15 79151645 missense probably damaging 1.00
R6313:Polr2f UTSW 15 79151373 missense probably damaging 1.00
R7494:Polr2f UTSW 15 79144665 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCTCATTCATGGTCAGCC -3'
(R):5'- CCTTAGAAAGAGCTAACAGTCACAG -3'

Sequencing Primer
(F):5'- ATTCATGGTCAGCCCCTGG -3'
(R):5'- GGGCCACCTTGATGTATGC -3'
Posted On2016-12-20