Incidental Mutation 'R5817:Fam13b'
ID 449134
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Name family with sequence similarity 13, member B
Synonyms 2610024E20Rik
MMRRC Submission 043397-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.323) question?
Stock # R5817 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 34575404-34639884 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34590850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 443 (M443V)
Ref Sequence ENSEMBL: ENSMUSP00000038199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040506]
AlphaFold Q8K2H3
Predicted Effect possibly damaging
Transcript: ENSMUST00000040506
AA Change: M443V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501
AA Change: M443V

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Meta Mutation Damage Score 0.0763 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,349,497 (GRCm39) I251M probably benign Het
Abcf3 T C 16: 20,367,833 (GRCm39) V63A possibly damaging Het
Agpat4 C T 17: 12,434,097 (GRCm39) probably benign Het
Ahcyl2 G A 6: 29,890,720 (GRCm39) V292M probably damaging Het
Ahnak2 A T 12: 112,740,437 (GRCm39) F406I probably damaging Het
Aqp7 G A 4: 41,035,510 (GRCm39) T115I probably benign Het
Arhgef5 G A 6: 43,252,038 (GRCm39) D930N probably benign Het
Cc2d2a G A 5: 43,869,760 (GRCm39) R887Q probably damaging Het
Ceacam18 A G 7: 43,291,265 (GRCm39) T236A probably benign Het
Chst15 A T 7: 131,870,873 (GRCm39) Y221N probably damaging Het
Chst15 G A 7: 131,870,876 (GRCm39) L220F probably damaging Het
Cntn2 G A 1: 132,446,486 (GRCm39) T784I probably benign Het
D630003M21Rik A G 2: 158,038,413 (GRCm39) L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 (GRCm39) D3894V probably damaging Het
Eif1ad19 G T 12: 87,740,201 (GRCm39) D119E probably benign Het
Fam20a T A 11: 109,564,244 (GRCm39) Q503L possibly damaging Het
Ftdc2 T C 16: 58,457,156 (GRCm39) I89V probably benign Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Gm5454 T A 13: 103,493,140 (GRCm39) noncoding transcript Het
Gm5581 A G 6: 131,144,132 (GRCm39) noncoding transcript Het
Gm6619 A G 6: 131,463,400 (GRCm39) I6V unknown Het
Gmcl1 A G 6: 86,691,230 (GRCm39) M255T probably damaging Het
Golm2 T A 2: 121,736,525 (GRCm39) S231T probably benign Het
Gprc5c T A 11: 114,754,450 (GRCm39) C42* probably null Het
Hmcn1 T A 1: 150,613,275 (GRCm39) E1384V possibly damaging Het
Il6 A G 5: 30,223,006 (GRCm39) I91V probably benign Het
Kmt2d A T 15: 98,760,244 (GRCm39) S1005T unknown Het
Map1a A T 2: 121,129,391 (GRCm39) H143L possibly damaging Het
Mical2 A T 7: 111,922,866 (GRCm39) T624S probably benign Het
Msh3 A T 13: 92,422,508 (GRCm39) N549K possibly damaging Het
Ncr1 T A 7: 4,343,894 (GRCm39) I164N possibly damaging Het
Or10ak11 T G 4: 118,687,296 (GRCm39) T115P probably damaging Het
Or51a5 A T 7: 102,771,115 (GRCm39) M292K possibly damaging Het
Or52m1 A G 7: 102,289,585 (GRCm39) N44S probably damaging Het
Or8d2b A G 9: 38,788,673 (GRCm39) D67G probably damaging Het
Palmd T C 3: 116,712,272 (GRCm39) I541M probably benign Het
Pcsk7 A T 9: 45,837,331 (GRCm39) M552L probably benign Het
Plekhh2 A G 17: 84,879,154 (GRCm39) E626G possibly damaging Het
Pole G A 5: 110,460,838 (GRCm39) D1176N probably damaging Het
Polr2f T C 15: 79,035,869 (GRCm39) I110T probably damaging Het
Pomt1 A T 2: 32,138,691 (GRCm39) I436F probably damaging Het
Prag1 A C 8: 36,570,857 (GRCm39) Q480P probably damaging Het
Qars1 C T 9: 108,387,441 (GRCm39) probably benign Het
Ralgapa2 G A 2: 146,175,406 (GRCm39) S1797L probably damaging Het
Rbm26 T C 14: 105,366,039 (GRCm39) T832A probably damaging Het
Rnf169 A G 7: 99,574,976 (GRCm39) S540P probably benign Het
Serpini1 T A 3: 75,520,631 (GRCm39) M76K probably benign Het
Shq1 A G 6: 100,550,681 (GRCm39) L419S probably damaging Het
Slc25a17 G A 15: 81,211,261 (GRCm39) T225M probably damaging Het
Slc6a5 C A 7: 49,606,239 (GRCm39) L716I probably benign Het
Smc1b A G 15: 84,951,984 (GRCm39) V1149A probably damaging Het
Trappc1 A T 11: 69,215,060 (GRCm39) Q26L possibly damaging Het
Trpm2 C A 10: 77,801,814 (GRCm39) G84W probably damaging Het
Ttn G A 2: 76,573,010 (GRCm39) T24215M probably damaging Het
Ubn2 C A 6: 38,456,088 (GRCm39) T337K probably damaging Het
Ubr4 A G 4: 139,196,158 (GRCm39) K1265E probably damaging Het
Vmn1r214 T G 13: 23,219,491 (GRCm39) I328M probably damaging Het
Xcr1 C T 9: 123,684,922 (GRCm39) C280Y possibly damaging Het
Zc3h13 A G 14: 75,565,572 (GRCm39) E895G probably damaging Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34,620,149 (GRCm39) missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34,587,771 (GRCm39) missense probably damaging 1.00
IGL00556:Fam13b APN 18 34,630,488 (GRCm39) missense probably damaging 0.99
IGL02123:Fam13b APN 18 34,578,671 (GRCm39) unclassified probably benign
IGL02313:Fam13b APN 18 34,587,709 (GRCm39) missense probably damaging 1.00
IGL02346:Fam13b APN 18 34,595,158 (GRCm39) missense probably benign 0.00
IGL02347:Fam13b APN 18 34,587,757 (GRCm39) missense probably damaging 1.00
IGL02694:Fam13b APN 18 34,584,259 (GRCm39) critical splice donor site probably null
IGL03347:Fam13b APN 18 34,595,104 (GRCm39) splice site probably benign
R0109:Fam13b UTSW 18 34,584,361 (GRCm39) missense probably benign 0.00
R0233:Fam13b UTSW 18 34,581,137 (GRCm39) missense probably damaging 1.00
R0455:Fam13b UTSW 18 34,578,581 (GRCm39) unclassified probably benign
R1229:Fam13b UTSW 18 34,578,636 (GRCm39) missense probably benign 0.05
R1397:Fam13b UTSW 18 34,578,636 (GRCm39) missense probably benign 0.05
R1571:Fam13b UTSW 18 34,630,485 (GRCm39) missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34,584,492 (GRCm39) critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34,620,187 (GRCm39) missense probably benign 0.04
R1777:Fam13b UTSW 18 34,590,813 (GRCm39) missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34,578,382 (GRCm39) missense possibly damaging 0.69
R2296:Fam13b UTSW 18 34,627,814 (GRCm39) missense possibly damaging 0.88
R3881:Fam13b UTSW 18 34,595,112 (GRCm39) critical splice donor site probably null
R3896:Fam13b UTSW 18 34,596,008 (GRCm39) splice site probably benign
R5277:Fam13b UTSW 18 34,595,243 (GRCm39) missense probably benign
R5759:Fam13b UTSW 18 34,630,488 (GRCm39) missense probably damaging 0.99
R5897:Fam13b UTSW 18 34,587,134 (GRCm39) missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34,630,458 (GRCm39) missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34,627,827 (GRCm39) missense probably damaging 1.00
R6087:Fam13b UTSW 18 34,620,192 (GRCm39) missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34,627,330 (GRCm39) missense probably damaging 0.96
R6454:Fam13b UTSW 18 34,590,715 (GRCm39) critical splice donor site probably null
R6464:Fam13b UTSW 18 34,606,684 (GRCm39) nonsense probably null
R6679:Fam13b UTSW 18 34,620,075 (GRCm39) missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34,631,079 (GRCm39) missense possibly damaging 0.86
R6990:Fam13b UTSW 18 34,630,500 (GRCm39) missense possibly damaging 0.92
R7420:Fam13b UTSW 18 34,627,664 (GRCm39) missense probably damaging 1.00
R7517:Fam13b UTSW 18 34,627,660 (GRCm39) missense probably damaging 0.98
R7534:Fam13b UTSW 18 34,631,060 (GRCm39) missense probably damaging 0.97
R7889:Fam13b UTSW 18 34,590,744 (GRCm39) missense probably benign 0.00
R8139:Fam13b UTSW 18 34,606,686 (GRCm39) missense possibly damaging 0.50
R8776:Fam13b UTSW 18 34,584,446 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Fam13b UTSW 18 34,584,446 (GRCm39) missense probably damaging 1.00
R8826:Fam13b UTSW 18 34,631,070 (GRCm39) missense probably damaging 0.96
R9166:Fam13b UTSW 18 34,595,252 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACAGGCCTGGAAGGATTTGTG -3'
(R):5'- CAGGCGGCAGTATAAATATGCTAG -3'

Sequencing Primer
(F):5'- GGATTTGTGTAGAGAATAAGAACTGC -3'
(R):5'- ATATGCTAGTATTTCTTGCTCTGATG -3'
Posted On 2016-12-20