Mutagenetix > Incidental Mutation

Incidental Mutation 'R0547:Pkd1l1'

44915

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l1

Ensembl Gene

ENSMUSG00000046634

Gene Name

polycystic kidney disease 1 like 1

Synonyms

MMRRC Submission

038739-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0547 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8826708-8973266 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 8836448 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000136518 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000178195]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000154153

SMART Domains

Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634

Domain	Start	End	E-Value	Type
low complexity region	172	184	N/A	INTRINSIC
PKD	205	287	2.9e0	SMART
PKD	291	369	1.42e-9	SMART
Pfam:REJ	398	1001	1.7e-45	PFAM
low complexity region	1208	1218	N/A	INTRINSIC
GPS	1370	1413	1.21e-1	SMART
transmembrane domain	1434	1451	N/A	INTRINSIC
LH2	1479	1598	2.94e-3	SMART
transmembrane domain	1640	1659	N/A	INTRINSIC
transmembrane domain	1679	1701	N/A	INTRINSIC
transmembrane domain	1817	1839	N/A	INTRINSIC
transmembrane domain	1854	1876	N/A	INTRINSIC
Pfam:PKD_channel	2109	2339	1.5e-23	PFAM
transmembrane domain	2381	2403	N/A	INTRINSIC
low complexity region	2436	2449	N/A	INTRINSIC
low complexity region	2458	2469	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178195

SMART Domains

Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634

Domain	Start	End	E-Value	Type
Pfam:REJ	3	552	3.3e-41	PFAM
low complexity region	757	767	N/A	INTRINSIC
Blast:GPS	919	965	2e-13	BLAST
transmembrane domain	983	1000	N/A	INTRINSIC
Pfam:PLAT	1030	1145	7.2e-14	PFAM
transmembrane domain	1189	1208	N/A	INTRINSIC
transmembrane domain	1228	1250	N/A	INTRINSIC
transmembrane domain	1366	1388	N/A	INTRINSIC
transmembrane domain	1403	1425	N/A	INTRINSIC
Pfam:PKD_channel	1658	1889	2e-25	PFAM
transmembrane domain	1930	1952	N/A	INTRINSIC
low complexity region	1985	1998	N/A	INTRINSIC
low complexity region	2007	2018	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057N15Rik	A	G	16: 88,773,610	Y181H	probably benign	Het
A530084C06Rik	A	G	13: 31,558,830		probably benign	Het
Adamtsl1	A	G	4: 86,356,355	D1208G	probably benign	Het
Ankrd55	T	C	13: 112,368,223	F501S	probably benign	Het
Aox2	G	A	1: 58,310,042	D656N	probably damaging	Het
Atr	A	T	9: 95,899,165		probably benign	Het
Bicra	G	A	7: 15,972,248	R1423W	probably damaging	Het
Cabyr	T	A	18: 12,751,016	S187T	probably benign	Het
Car5b	G	A	X: 163,979,301	R282C	probably damaging	Het
Cdon	A	T	9: 35,457,498	T343S	possibly damaging	Het
Cep350	C	T	1: 155,901,435		probably null	Het
Copa	T	C	1: 172,121,687		probably benign	Het
Cyp4f18	T	C	8: 71,996,010	D265G	probably benign	Het
Dgkb	T	A	12: 38,604,158	C759S	probably benign	Het
Dnah6	T	C	6: 73,044,774	M3470V	probably benign	Het
Eif4g2	T	C	7: 111,078,293	N177S	probably damaging	Het
Etfb	C	T	7: 43,454,578	Q145*	probably null	Het
Flnb	T	A	14: 7,912,943		probably null	Het
G430095P16Rik	G	A	8: 84,726,642		probably benign	Het
Gfral	A	T	9: 76,208,642	S17T	probably benign	Het
Gm884	T	C	11: 103,620,164	N326S	unknown	Het
Gpr26	T	C	7: 131,984,297	I332T	probably benign	Het
Greb1	T	A	12: 16,723,411	T221S	probably benign	Het
Haus5	A	T	7: 30,659,083	S289T	probably damaging	Het
Ighv6-4	T	C	12: 114,406,601	Y77C	probably damaging	Het
Il23r	A	T	6: 67,423,701	D548E	probably benign	Het
Il23r	A	T	6: 67,486,251	F86Y	possibly damaging	Het
Inppl1	A	T	7: 101,831,003	M424K	probably benign	Het
Jam3	A	G	9: 27,098,888	Y267H	probably damaging	Het
Mms19	A	T	19: 41,963,418	M160K	probably damaging	Het
Muc2	CGTG	CGTGTG	7: 141,699,185		probably null	Het
Mup5	A	G	4: 61,833,000	L137P	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Ntrk2	G	A	13: 58,874,370	S413N	probably damaging	Het
Nuak2	C	A	1: 132,332,203	T573N	probably benign	Het
Odf3	A	G	7: 140,848,815		probably null	Het
Olfr651	G	A	7: 104,553,356	V146M	probably benign	Het
Olfr734	A	T	14: 50,320,118	I239K	probably benign	Het
Padi4	GCTGCGTACCTCCAC	GC	4: 140,748,449		probably benign	Het
Pclo	T	A	5: 14,792,072	I4787N	unknown	Het
Pde8a	G	T	7: 81,324,130	V612L	probably benign	Het
Pear1	A	T	3: 87,788,800		probably null	Het
Pgbd1	A	G	13: 21,423,518	Y169H	probably damaging	Het
Prkag3	C	T	1: 74,744,720		probably null	Het
Rsph9	A	T	17: 46,144,124	S9T	possibly damaging	Het
Rxfp1	A	T	3: 79,705,569		probably null	Het
Senp7	A	G	16: 56,175,826	E756G	probably damaging	Het
Serpina1e	G	T	12: 103,949,191	T252K	probably benign	Het
Sipa1l1	T	A	12: 82,437,736	S1555T	probably benign	Het
Slain1	T	C	14: 103,695,275	S432P	probably damaging	Het
Slc37a2	A	T	9: 37,233,122		probably null	Het
Thg1l	C	T	11: 45,954,191	R18Q	probably damaging	Het
Tnn	A	G	1: 160,116,337		probably benign	Het
Trim32	G	A	4: 65,613,254	R16Q	probably damaging	Het
Tshz3	A	G	7: 36,771,417	T944A	probably damaging	Het
Ttn	C	G	2: 76,854,430		probably benign	Het
Ythdc2	T	C	18: 44,840,264	S323P	possibly damaging	Het
Zfp827	A	G	8: 79,060,310	N35S	probably damaging	Het

Other mutations in Pkd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Pkd1l1	APN	11	8961971	missense	unknown
IGL00156:Pkd1l1	APN	11	8950515	missense	probably damaging	1.00
IGL00161:Pkd1l1	APN	11	8929353	critical splice donor site	probably null
IGL00489:Pkd1l1	APN	11	8834773	critical splice donor site	probably null
IGL00495:Pkd1l1	APN	11	8868493	missense	probably benign	0.34
IGL00983:Pkd1l1	APN	11	8844585	missense	probably benign
IGL01071:Pkd1l1	APN	11	8848921	missense	probably benign	0.00
IGL01093:Pkd1l1	APN	11	8901345	missense	probably benign	0.06
IGL01295:Pkd1l1	APN	11	8933685	missense	possibly damaging	0.93
IGL01311:Pkd1l1	APN	11	8901174	missense	possibly damaging	0.53
IGL01412:Pkd1l1	APN	11	8950409	missense	possibly damaging	0.73
IGL01978:Pkd1l1	APN	11	8961336	missense	unknown
IGL01999:Pkd1l1	APN	11	8836291	missense	probably benign
IGL02080:Pkd1l1	APN	11	8961345	missense	unknown
IGL02106:Pkd1l1	APN	11	8833800	missense	probably damaging	1.00
IGL02216:Pkd1l1	APN	11	8834897	missense	probably damaging	0.96
IGL02305:Pkd1l1	APN	11	8902467	missense	probably benign
IGL02337:Pkd1l1	APN	11	8942079	missense	probably damaging	1.00
IGL02576:Pkd1l1	APN	11	8844560	missense	possibly damaging	0.61
IGL02704:Pkd1l1	APN	11	8834910	missense	probably benign	0.00
IGL02814:Pkd1l1	APN	11	8902582	missense	probably benign	0.01
IGL02904:Pkd1l1	APN	11	8868450	splice site	probably benign
IGL02972:Pkd1l1	APN	11	8863908	missense	probably damaging	0.99
IGL03091:Pkd1l1	APN	11	8855564	missense	probably damaging	1.00
IGL03113:Pkd1l1	APN	11	8834793	missense	probably benign	0.20
IGL03210:Pkd1l1	APN	11	8965127	missense	unknown
PIT4581001:Pkd1l1	UTSW	11	8916298	frame shift	probably null
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0496:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
R0582:Pkd1l1	UTSW	11	8931699	splice site	probably benign
R0761:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R0969:Pkd1l1	UTSW	11	8936898	missense	probably damaging	1.00
R1348:Pkd1l1	UTSW	11	8834806	missense	probably benign	0.18
R1366:Pkd1l1	UTSW	11	8941038	splice site	probably benign
R1401:Pkd1l1	UTSW	11	8854487	nonsense	probably null
R1444:Pkd1l1	UTSW	11	8854386	missense	probably damaging	1.00
R1445:Pkd1l1	UTSW	11	8870313	missense	probably benign	0.00
R1463:Pkd1l1	UTSW	11	8916302	missense	probably damaging	1.00
R1496:Pkd1l1	UTSW	11	8941077	missense	possibly damaging	0.95
R1542:Pkd1l1	UTSW	11	8874179	missense	possibly damaging	0.82
R1543:Pkd1l1	UTSW	11	8901200	missense	probably damaging	1.00
R1619:Pkd1l1	UTSW	11	8950413	missense	probably damaging	0.98
R1875:Pkd1l1	UTSW	11	8844670	splice site	probably benign
R1929:Pkd1l1	UTSW	11	8836197	splice site	probably benign
R1958:Pkd1l1	UTSW	11	8874161	missense	probably benign	0.01
R2223:Pkd1l1	UTSW	11	8889063	missense	probably benign	0.18
R2223:Pkd1l1	UTSW	11	8950422	missense	probably benign
R2264:Pkd1l1	UTSW	11	8879112	missense	probably damaging	0.97
R2349:Pkd1l1	UTSW	11	8826819	splice site	probably null
R2431:Pkd1l1	UTSW	11	8947197	missense	probably damaging	0.99
R2483:Pkd1l1	UTSW	11	8962701	missense	probably damaging	1.00
R2517:Pkd1l1	UTSW	11	8958900	missense	unknown
R2888:Pkd1l1	UTSW	11	8947251	missense	probably damaging	1.00
R2965:Pkd1l1	UTSW	11	8874236	missense	probably damaging	1.00
R3123:Pkd1l1	UTSW	11	8973021	missense	unknown
R3153:Pkd1l1	UTSW	11	8867207	missense	probably benign	0.01
R3840:Pkd1l1	UTSW	11	8889050	missense	probably damaging	1.00
R3855:Pkd1l1	UTSW	11	8965047	critical splice donor site	probably null
R3880:Pkd1l1	UTSW	11	8961983	missense	unknown
R3970:Pkd1l1	UTSW	11	8874218	missense	probably damaging	1.00
R4195:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4196:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4246:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4247:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4249:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4250:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4593:Pkd1l1	UTSW	11	8901253	missense	probably damaging	0.97
R4609:Pkd1l1	UTSW	11	8958964	missense	unknown
R4797:Pkd1l1	UTSW	11	8961340	missense	unknown
R4910:Pkd1l1	UTSW	11	8929360	missense	possibly damaging	0.50
R4940:Pkd1l1	UTSW	11	8844585	missense	probably benign
R5084:Pkd1l1	UTSW	11	8942004	missense	probably benign	0.05
R5147:Pkd1l1	UTSW	11	8849003	missense	possibly damaging	0.71
R5360:Pkd1l1	UTSW	11	8879204	missense	probably benign
R5483:Pkd1l1	UTSW	11	8901141	critical splice donor site	probably null
R5604:Pkd1l1	UTSW	11	8833877	missense	probably damaging	0.98
R5642:Pkd1l1	UTSW	11	8879202	missense	probably damaging	1.00
R5652:Pkd1l1	UTSW	11	8909889	missense	probably benign	0.03
R5751:Pkd1l1	UTSW	11	8867204	missense	possibly damaging	0.45
R5761:Pkd1l1	UTSW	11	8916301	missense	probably damaging	1.00
R5800:Pkd1l1	UTSW	11	8861302	missense	probably benign
R5874:Pkd1l1	UTSW	11	8908688	missense	probably damaging	1.00
R5897:Pkd1l1	UTSW	11	8879176	missense	probably benign	0.03
R5913:Pkd1l1	UTSW	11	8863849	missense	probably benign	0.00
R5930:Pkd1l1	UTSW	11	8958969	missense	unknown
R6000:Pkd1l1	UTSW	11	8950427	missense	probably benign	0.00
R6005:Pkd1l1	UTSW	11	8857113	missense	probably damaging	1.00
R6013:Pkd1l1	UTSW	11	8869452	splice site	probably null
R6027:Pkd1l1	UTSW	11	8916272	nonsense	probably null
R6028:Pkd1l1	UTSW	11	8836267	missense	probably benign	0.06
R6129:Pkd1l1	UTSW	11	8868543	missense	probably benign	0.00
R6182:Pkd1l1	UTSW	11	8865555	missense	probably benign	0.36
R6226:Pkd1l1	UTSW	11	8901287	missense	probably benign	0.00
R6257:Pkd1l1	UTSW	11	8942195	missense	probably benign	0.22
R6340:Pkd1l1	UTSW	11	8844649	missense	probably benign	0.09
R6478:Pkd1l1	UTSW	11	8863911	missense	probably benign	0.00
R6558:Pkd1l1	UTSW	11	8889052	missense	probably benign	0.00
R6750:Pkd1l1	UTSW	11	8973217	missense	unknown
R6987:Pkd1l1	UTSW	11	8902575	missense	probably benign	0.01
R6996:Pkd1l1	UTSW	11	8849046	missense	probably damaging	1.00
R7139:Pkd1l1	UTSW	11	8890737	missense
R7224:Pkd1l1	UTSW	11	8945241	missense
R7244:Pkd1l1	UTSW	11	8871771	missense
R7265:Pkd1l1	UTSW	11	8929402	missense
R7358:Pkd1l1	UTSW	11	8945202	missense
R7387:Pkd1l1	UTSW	11	8901203	missense
R7414:Pkd1l1	UTSW	11	8916267	missense
R7459:Pkd1l1	UTSW	11	8902428	missense
R7478:Pkd1l1	UTSW	11	8929441	missense
R7485:Pkd1l1	UTSW	11	8965148	missense
R7490:Pkd1l1	UTSW	11	8916265	missense
R7644:Pkd1l1	UTSW	11	8875758	missense
R7647:Pkd1l1	UTSW	11	8947296	missense
R7676:Pkd1l1	UTSW	11	8962708	missense
R7687:Pkd1l1	UTSW	11	8854390	missense
R7699:Pkd1l1	UTSW	11	8965142	missense
R7922:Pkd1l1	UTSW	11	8849013	missense
R7922:Pkd1l1	UTSW	11	8909857	missense
R7980:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R7993:Pkd1l1	UTSW	11	8945262	missense
R8052:Pkd1l1	UTSW	11	8947315	missense
R8125:Pkd1l1	UTSW	11	8947241	missense	probably damaging	1.00
R8420:Pkd1l1	UTSW	11	8870277	nonsense	probably null
R8675:Pkd1l1	UTSW	11	8848916	critical splice donor site	probably null
R8683:Pkd1l1	UTSW	11	8871805	missense
R8709:Pkd1l1	UTSW	11	8855567	missense
R8711:Pkd1l1	UTSW	11	8865550	missense
R8725:Pkd1l1	UTSW	11	8961482	missense
R8733:Pkd1l1	UTSW	11	8933657	missense
R8822:Pkd1l1	UTSW	11	8856312	missense
R8871:Pkd1l1	UTSW	11	8950503	missense
R9009:Pkd1l1	UTSW	11	8931552	missense
R9099:Pkd1l1	UTSW	11	8972986	missense
R9119:Pkd1l1	UTSW	11	8879107	missense
R9150:Pkd1l1	UTSW	11	8836256	missense
R9314:Pkd1l1	UTSW	11	8879153	missense
R9341:Pkd1l1	UTSW	11	8836399	missense
R9341:Pkd1l1	UTSW	11	8961305	missense
R9343:Pkd1l1	UTSW	11	8836399	missense
R9343:Pkd1l1	UTSW	11	8961305	missense
R9392:Pkd1l1	UTSW	11	8844567	missense
R9424:Pkd1l1	UTSW	11	8870091	missense
R9496:Pkd1l1	UTSW	11	8833773	critical splice donor site	probably null
R9504:Pkd1l1	UTSW	11	8865631	missense
R9563:Pkd1l1	UTSW	11	8865502	missense
R9570:Pkd1l1	UTSW	11	8890697	missense
R9585:Pkd1l1	UTSW	11	8854390	missense
R9618:Pkd1l1	UTSW	11	8961420	missense
R9709:Pkd1l1	UTSW	11	8849016	missense	probably damaging	0.98
R9741:Pkd1l1	UTSW	11	8947224	missense
R9801:Pkd1l1	UTSW	11	8958964	nonsense	probably null
X0024:Pkd1l1	UTSW	11	8950413	missense	probably benign	0.01
X0063:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
X0065:Pkd1l1	UTSW	11	8909921	missense	probably benign	0.10
Z1176:Pkd1l1	UTSW	11	8826801	missense
Z1177:Pkd1l1	UTSW	11	8945208	missense

Predicted Primers

PCR Primer
(F):5'- CATTCTGAAACCCAGAGTAGCCAGC -3'
(R):5'- ACCAGTTTGCCTCTAAGCAGCC -3'

Sequencing Primer
(F):5'- TCCGTGGTCAGACTTCAAACAG -3'
(R):5'- CTAAGCAGCCCTTCCTGAC -3'

Posted On

2013-06-11