Incidental Mutation 'R5818:Olfr149'
ID449165
Institutional Source Beutler Lab
Gene Symbol Olfr149
Ensembl Gene ENSMUSG00000062121
Gene Nameolfactory receptor 149
SynonymsGA_x6K02T2PVTD-33400306-33399371, MOR224-8, M31
MMRRC Submission 043398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5818 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39700518-39707117 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39702365 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 135 (S135G)
Ref Sequence ENSEMBL: ENSMUSP00000149664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082027] [ENSMUST00000215192]
Predicted Effect probably benign
Transcript: ENSMUST00000082027
AA Change: S135G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080686
Gene: ENSMUSG00000062121
AA Change: S135G

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 33 223 3.8e-9 PFAM
Pfam:7tm_1 39 286 1.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215192
AA Change: S135G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,643 V560D probably damaging Het
Actn4 A G 7: 28,919,019 I72T probably damaging Het
Adam33 A T 2: 131,054,358 C440S possibly damaging Het
Bace1 T C 9: 45,859,049 I361T possibly damaging Het
Bend6 T C 1: 33,883,573 probably benign Het
Bpifb9a T G 2: 154,262,295 N219K probably damaging Het
Cacna1g C A 11: 94,418,120 K1634N probably damaging Het
Ccdc155 C T 7: 45,193,959 probably null Het
Cdk18 A G 1: 132,119,098 probably null Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Corin G T 5: 72,435,395 H87N probably benign Het
Cps1 A T 1: 67,166,488 I557F possibly damaging Het
Cyp4a29 T C 4: 115,247,032 V99A possibly damaging Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Dgat1 G A 15: 76,502,207 probably benign Het
Fbxw26 G T 9: 109,732,566 R187S probably benign Het
Gabrd G A 4: 155,388,361 P122S probably damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm8300 T G 12: 87,517,060 V55G possibly damaging Het
Hif1a A G 12: 73,939,564 Q343R possibly damaging Het
Hyou1 G A 9: 44,388,926 probably null Het
Igfn1 A T 1: 135,966,126 I2072K possibly damaging Het
Kctd8 C T 5: 69,296,711 A328T probably benign Het
Krt10 A G 11: 99,388,771 Y188H probably damaging Het
Krtap4-16 T A 11: 99,851,523 Q17L unknown Het
Larp4b T A 13: 9,158,560 S416R probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Mroh4 A G 15: 74,611,982 I571T probably damaging Het
Myo15 G A 11: 60,497,951 R2021Q probably benign Het
Npl G A 1: 153,535,915 R63C probably damaging Het
Ntn4 A G 10: 93,644,764 I80V probably benign Het
Numb C T 12: 83,825,254 probably null Het
Nusap1 A C 2: 119,635,513 M205L possibly damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Pmfbp1 T C 8: 109,538,679 probably null Het
Ppfia1 T C 7: 144,520,568 probably benign Het
Ppm1b A G 17: 84,993,719 K9R probably benign Het
Rab11fip3 T C 17: 26,016,116 S608G probably damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Sohlh2 A G 3: 55,190,501 T125A probably damaging Het
Ssfa2 T A 2: 79,644,593 S299T probably damaging Het
Tet1 C A 10: 62,816,408 M1610I possibly damaging Het
Tgfbr3 A T 5: 107,133,003 D630E probably benign Het
Thnsl2 T C 6: 71,134,143 D247G probably benign Het
Tmem198b G A 10: 128,802,188 R169W probably benign Het
Tmem201 G A 4: 149,727,392 A332V probably benign Het
Tsku T C 7: 98,352,098 D342G possibly damaging Het
Ucn2 A T 9: 108,986,497 H109L probably benign Het
Virma T G 4: 11,513,319 L391R possibly damaging Het
Vmn1r60 T A 7: 5,545,099 M1L probably benign Het
Vmn2r76 T C 7: 86,229,934 H386R probably benign Het
Zfp608 C T 18: 54,895,396 R1315Q probably benign Het
Zmym2 A G 14: 56,946,529 T983A probably benign Het
Zscan26 A G 13: 21,445,761 S65P probably benign Het
Other mutations in Olfr149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Olfr149 APN 9 39702253 missense probably damaging 1.00
IGL02707:Olfr149 APN 9 39702641 missense probably damaging 0.99
IGL02730:Olfr149 APN 9 39702238 missense probably damaging 1.00
IGL03375:Olfr149 APN 9 39702575 missense probably damaging 1.00
R0244:Olfr149 UTSW 9 39702173 missense probably damaging 0.97
R0358:Olfr149 UTSW 9 39702001 missense possibly damaging 0.95
R4179:Olfr149 UTSW 9 39702091 missense probably benign 0.30
R5120:Olfr149 UTSW 9 39702070 missense probably benign 0.00
R5185:Olfr149 UTSW 9 39701876 missense probably benign
R6029:Olfr149 UTSW 9 39702400 missense probably damaging 1.00
R6207:Olfr149 UTSW 9 39702310 missense probably benign 0.06
R6454:Olfr149 UTSW 9 39701834 makesense probably null
R7451:Olfr149 UTSW 9 39702127 missense probably damaging 0.99
R8193:Olfr149 UTSW 9 39702202 missense possibly damaging 0.90
R8263:Olfr149 UTSW 9 39702157 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ATCTCCAGGGTCGATGTGTC -3'
(R):5'- GGCTTCACACTCCCATGTAC -3'

Sequencing Primer
(F):5'- GTGTCTGCACAAGCCAGCTTC -3'
(R):5'- TGTGAGTTCTCCCAAGATGC -3'
Posted On2016-12-20