Mutagenetix > Incidental Mutations

Incidental Mutation 'R5818:Ntn4'

449172

Institutional Source

Beutler Lab

Gene Symbol

Ntn4

Ensembl Gene

ENSMUSG00000020019

Gene Name

netrin 4

Synonyms

beta-netrin

MMRRC Submission

043398-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5818 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93640681-93747207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93644764 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 80 (I80V)

Ref Sequence

ENSEMBL: ENSMUSP00000123306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020204] [ENSMUST00000147080]

Predicted Effect

probably benign
Transcript: ENSMUST00000020204
AA Change: I117V

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: I117V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	28	260	6.48e-55	SMART
EGF_Lam	262	329	5.83e-7	SMART
EGF_Lam	332	392	3.32e-11	SMART
EGF_Lam	395	446	3.73e-14	SMART
C345C	516	625	5.58e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147080
AA Change: I80V

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000123306
Gene: ENSMUSG00000020019
AA Change: I80V

Domain	Start	End	E-Value	Type
LamNT	1	143	4.24e-12	SMART

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,219,643	V560D	probably damaging	Het
Actn4	A	G	7: 28,919,019	I72T	probably damaging	Het
Adam33	A	T	2: 131,054,358	C440S	possibly damaging	Het
Bace1	T	C	9: 45,859,049	I361T	possibly damaging	Het
Bend6	T	C	1: 33,883,573		probably benign	Het
Bpifb9a	T	G	2: 154,262,295	N219K	probably damaging	Het
Cacna1g	C	A	11: 94,418,120	K1634N	probably damaging	Het
Ccdc155	C	T	7: 45,193,959		probably null	Het
Cdk18	A	G	1: 132,119,098		probably null	Het
Chrng	G	A	1: 87,209,801	V320I	probably benign	Het
Corin	G	T	5: 72,435,395	H87N	probably benign	Het
Cps1	A	T	1: 67,166,488	I557F	possibly damaging	Het
Cyp4a29	T	C	4: 115,247,032	V99A	possibly damaging	Het
Dach1	T	C	14: 98,168,684	D209G	probably damaging	Het
Dgat1	G	A	15: 76,502,207		probably benign	Het
Fbxw26	G	T	9: 109,732,566	R187S	probably benign	Het
Gabrd	G	A	4: 155,388,361	P122S	probably damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm8300	T	G	12: 87,517,060	V55G	possibly damaging	Het
Hif1a	A	G	12: 73,939,564	Q343R	possibly damaging	Het
Hyou1	G	A	9: 44,388,926		probably null	Het
Igfn1	A	T	1: 135,966,126	I2072K	possibly damaging	Het
Kctd8	C	T	5: 69,296,711	A328T	probably benign	Het
Krt10	A	G	11: 99,388,771	Y188H	probably damaging	Het
Krtap4-16	T	A	11: 99,851,523	Q17L	unknown	Het
Larp4b	T	A	13: 9,158,560	S416R	probably benign	Het
Lmtk2	G	A	5: 144,156,900	V232M	probably benign	Het
Mroh4	A	G	15: 74,611,982	I571T	probably damaging	Het
Myo15	G	A	11: 60,497,951	R2021Q	probably benign	Het
Npl	G	A	1: 153,535,915	R63C	probably damaging	Het
Numb	C	T	12: 83,825,254		probably null	Het
Nusap1	A	C	2: 119,635,513	M205L	possibly damaging	Het
Olfr149	T	C	9: 39,702,365	S135G	probably benign	Het
Onecut2	T	A	18: 64,340,975	M180K	possibly damaging	Het
Pmfbp1	T	C	8: 109,538,679		probably null	Het
Ppfia1	T	C	7: 144,520,568		probably benign	Het
Ppm1b	A	G	17: 84,993,719	K9R	probably benign	Het
Rab11fip3	T	C	17: 26,016,116	S608G	probably damaging	Het
Smim8	TTTAATGAAGAGCT	TT	4: 34,771,261		probably benign	Het
Sohlh2	A	G	3: 55,190,501	T125A	probably damaging	Het
Ssfa2	T	A	2: 79,644,593	S299T	probably damaging	Het
Tet1	C	A	10: 62,816,408	M1610I	possibly damaging	Het
Tgfbr3	A	T	5: 107,133,003	D630E	probably benign	Het
Thnsl2	T	C	6: 71,134,143	D247G	probably benign	Het
Tmem198b	G	A	10: 128,802,188	R169W	probably benign	Het
Tmem201	G	A	4: 149,727,392	A332V	probably benign	Het
Tsku	T	C	7: 98,352,098	D342G	possibly damaging	Het
Ucn2	A	T	9: 108,986,497	H109L	probably benign	Het
Virma	T	G	4: 11,513,319	L391R	possibly damaging	Het
Vmn1r60	T	A	7: 5,545,099	M1L	probably benign	Het
Vmn2r76	T	C	7: 86,229,934	H386R	probably benign	Het
Zfp608	C	T	18: 54,895,396	R1315Q	probably benign	Het
Zmym2	A	G	14: 56,946,529	T983A	probably benign	Het
Zscan26	A	G	13: 21,445,761	S65P	probably benign	Het

Other mutations in Ntn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02052:Ntn4	APN	10	93707349	missense	probably damaging	1.00
IGL02212:Ntn4	APN	10	93644849	missense	possibly damaging	0.50
IGL02698:Ntn4	APN	10	93644659	missense	probably benign	0.19
IGL02752:Ntn4	APN	10	93710559	missense	possibly damaging	0.84
PIT4468001:Ntn4	UTSW	10	93644725	missense	probably damaging	0.99
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0132:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0419:Ntn4	UTSW	10	93682429	missense	probably benign	0.04
R1304:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1306:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1307:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1308:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1619:Ntn4	UTSW	10	93644734	missense	probably damaging	1.00
R1645:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1664:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1695:Ntn4	UTSW	10	93733602	splice site	probably null
R1796:Ntn4	UTSW	10	93745771	missense	probably damaging	1.00
R1806:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1845:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1856:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1872:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1879:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1901:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1902:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1925:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1926:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1927:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2060:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2113:Ntn4	UTSW	10	93644839	missense	probably damaging	1.00
R2202:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2203:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2975:Ntn4	UTSW	10	93644891	missense	probably damaging	1.00
R4277:Ntn4	UTSW	10	93741210	missense	possibly damaging	0.95
R4805:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4806:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4807:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R6048:Ntn4	UTSW	10	93707266	splice site	probably null
R6051:Ntn4	UTSW	10	93745795	missense	probably benign
R6346:Ntn4	UTSW	10	93644861	missense	probably damaging	1.00
R6752:Ntn4	UTSW	10	93734175	missense	probably benign
R7196:Ntn4	UTSW	10	93733714	missense	probably benign	0.01
R7240:Ntn4	UTSW	10	93745741	missense	probably damaging	0.99
R7365:Ntn4	UTSW	10	93644804	missense	probably damaging	1.00
R7374:Ntn4	UTSW	10	93682572	missense	probably benign
R7505:Ntn4	UTSW	10	93707284	missense	probably damaging	1.00
R7509:Ntn4	UTSW	10	93710568	missense	probably benign	0.01
R7726:Ntn4	UTSW	10	93733682	missense	possibly damaging	0.82
R7957:Ntn4	UTSW	10	93644473	splice site	probably benign
R8092:Ntn4	UTSW	10	93741056	missense	probably damaging	0.97
R8202:Ntn4	UTSW	10	93644903	missense	possibly damaging	0.88
R8508:Ntn4	UTSW	10	93741104	missense	possibly damaging	0.48
RF045:Ntn4	UTSW	10	93710625	missense	possibly damaging	0.95
X0024:Ntn4	UTSW	10	93644971	missense	probably damaging	1.00
Z1176:Ntn4	UTSW	10	93741153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGGGAAGAAAGCTCCGGG -3'
(R):5'- TTGACAACATCATCTTCCAGGC -3'

Sequencing Primer
(F):5'- CACAATGTGTGGCCAGAACGC -3'
(R):5'- CCAAAAGTAGCCGAGCAGTTTG -3'

Posted On

2016-12-20