Mutagenetix > Incidental Mutations

Incidental Mutation 'R5818:Myo15'

449174

Institutional Source

Beutler Lab

Gene Symbol

Myo15

Ensembl Gene

ENSMUSG00000042678

Gene Name

myosin XV

Synonyms

sh2; sh-2; Myo15a

MMRRC Submission

043398-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5818 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60469339-60528369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 60497951 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 2021 (R2021Q)

Ref Sequence

ENSEMBL: ENSMUSP00000091686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]

Predicted Effect

probably benign
Transcript: ENSMUST00000071880
AA Change: R2039Q

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: R2039Q

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	87	100	N/A	INTRINSIC
low complexity region	107	120	N/A	INTRINSIC
low complexity region	269	292	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
low complexity region	311	325	N/A	INTRINSIC
low complexity region	349	384	N/A	INTRINSIC
low complexity region	425	435	N/A	INTRINSIC
low complexity region	487	498	N/A	INTRINSIC
low complexity region	502	509	N/A	INTRINSIC
low complexity region	653	681	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	758	775	N/A	INTRINSIC
low complexity region	781	792	N/A	INTRINSIC
low complexity region	796	809	N/A	INTRINSIC
low complexity region	825	849	N/A	INTRINSIC
low complexity region	883	897	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
low complexity region	1115	1130	N/A	INTRINSIC
MYSc	1200	1884	N/A	SMART
IQ	1885	1907	1.63e-1	SMART
IQ	1908	1930	1.77e-2	SMART
IQ	1931	1953	2.97e2	SMART
low complexity region	1955	1974	N/A	INTRINSIC
low complexity region	1992	2006	N/A	INTRINSIC
MyTH4	2049	2195	1.8e-42	SMART
low complexity region	2396	2405	N/A	INTRINSIC
low complexity region	2451	2461	N/A	INTRINSIC
Blast:MYSc	2665	2848	2e-14	BLAST
SH3	2851	2933	1.55e-4	SMART
low complexity region	2949	2962	N/A	INTRINSIC
MyTH4	3031	3185	5.59e-48	SMART
B41	3188	3400	6.94e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000081823
AA Change: R834Q

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: R834Q

Domain	Start	End	E-Value	Type
MYSc	13	697	N/A	SMART
IQ	698	720	1.63e-1	SMART
IQ	721	743	1.77e-2	SMART
IQ	744	766	2.97e2	SMART
low complexity region	787	801	N/A	INTRINSIC
MyTH4	844	990	1.8e-42	SMART
low complexity region	1191	1200	N/A	INTRINSIC
low complexity region	1246	1256	N/A	INTRINSIC
Blast:MYSc	1460	1643	7e-15	BLAST
SH3	1646	1728	1.55e-4	SMART
low complexity region	1744	1757	N/A	INTRINSIC
MyTH4	1826	1980	5.59e-48	SMART
B41	1983	2195	6.94e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094135
AA Change: R2021Q

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: R2021Q

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	87	100	N/A	INTRINSIC
low complexity region	107	120	N/A	INTRINSIC
low complexity region	269	292	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
low complexity region	311	325	N/A	INTRINSIC
low complexity region	349	384	N/A	INTRINSIC
low complexity region	425	435	N/A	INTRINSIC
low complexity region	487	498	N/A	INTRINSIC
low complexity region	502	509	N/A	INTRINSIC
low complexity region	653	681	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	758	775	N/A	INTRINSIC
low complexity region	781	792	N/A	INTRINSIC
low complexity region	796	809	N/A	INTRINSIC
low complexity region	825	849	N/A	INTRINSIC
low complexity region	883	897	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
low complexity region	1115	1130	N/A	INTRINSIC
MYSc	1200	1884	N/A	SMART
IQ	1885	1907	1.63e-1	SMART
IQ	1908	1930	1.77e-2	SMART
IQ	1931	1953	2.97e2	SMART
low complexity region	1974	1988	N/A	INTRINSIC
MyTH4	2031	2177	1.8e-42	SMART
low complexity region	2378	2387	N/A	INTRINSIC
low complexity region	2433	2443	N/A	INTRINSIC
Blast:MYSc	2647	2830	2e-14	BLAST
SH3	2833	2915	1.55e-4	SMART
low complexity region	2931	2944	N/A	INTRINSIC
MyTH4	3013	3167	5.59e-48	SMART
B41	3170	3382	6.94e-3	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000126522
AA Change: R852Q

SMART Domains

Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: R852Q

Domain	Start	End	E-Value	Type
MYSc	34	716	N/A	SMART
IQ	717	739	1.63e-1	SMART
IQ	740	762	1.77e-2	SMART
IQ	763	785	2.97e2	SMART
low complexity region	806	820	N/A	INTRINSIC
MyTH4	863	1009	1.8e-42	SMART
low complexity region	1210	1219	N/A	INTRINSIC
low complexity region	1265	1275	N/A	INTRINSIC
Blast:MYSc	1479	1662	5e-15	BLAST
SH3	1665	1747	1.55e-4	SMART
low complexity region	1763	1776	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,219,643	V560D	probably damaging	Het
Actn4	A	G	7: 28,919,019	I72T	probably damaging	Het
Adam33	A	T	2: 131,054,358	C440S	possibly damaging	Het
Bace1	T	C	9: 45,859,049	I361T	possibly damaging	Het
Bend6	T	C	1: 33,883,573		probably benign	Het
Bpifb9a	T	G	2: 154,262,295	N219K	probably damaging	Het
Cacna1g	C	A	11: 94,418,120	K1634N	probably damaging	Het
Ccdc155	C	T	7: 45,193,959		probably null	Het
Cdk18	A	G	1: 132,119,098		probably null	Het
Chrng	G	A	1: 87,209,801	V320I	probably benign	Het
Corin	G	T	5: 72,435,395	H87N	probably benign	Het
Cps1	A	T	1: 67,166,488	I557F	possibly damaging	Het
Cyp4a29	T	C	4: 115,247,032	V99A	possibly damaging	Het
Dach1	T	C	14: 98,168,684	D209G	probably damaging	Het
Dgat1	G	A	15: 76,502,207		probably benign	Het
Fbxw26	G	T	9: 109,732,566	R187S	probably benign	Het
Gabrd	G	A	4: 155,388,361	P122S	probably damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm8300	T	G	12: 87,517,060	V55G	possibly damaging	Het
Hif1a	A	G	12: 73,939,564	Q343R	possibly damaging	Het
Hyou1	G	A	9: 44,388,926		probably null	Het
Igfn1	A	T	1: 135,966,126	I2072K	possibly damaging	Het
Kctd8	C	T	5: 69,296,711	A328T	probably benign	Het
Krt10	A	G	11: 99,388,771	Y188H	probably damaging	Het
Krtap4-16	T	A	11: 99,851,523	Q17L	unknown	Het
Larp4b	T	A	13: 9,158,560	S416R	probably benign	Het
Lmtk2	G	A	5: 144,156,900	V232M	probably benign	Het
Mroh4	A	G	15: 74,611,982	I571T	probably damaging	Het
Npl	G	A	1: 153,535,915	R63C	probably damaging	Het
Ntn4	A	G	10: 93,644,764	I80V	probably benign	Het
Numb	C	T	12: 83,825,254		probably null	Het
Nusap1	A	C	2: 119,635,513	M205L	possibly damaging	Het
Olfr149	T	C	9: 39,702,365	S135G	probably benign	Het
Onecut2	T	A	18: 64,340,975	M180K	possibly damaging	Het
Pmfbp1	T	C	8: 109,538,679		probably null	Het
Ppfia1	T	C	7: 144,520,568		probably benign	Het
Ppm1b	A	G	17: 84,993,719	K9R	probably benign	Het
Rab11fip3	T	C	17: 26,016,116	S608G	probably damaging	Het
Smim8	TTTAATGAAGAGCT	TT	4: 34,771,261		probably benign	Het
Sohlh2	A	G	3: 55,190,501	T125A	probably damaging	Het
Ssfa2	T	A	2: 79,644,593	S299T	probably damaging	Het
Tet1	C	A	10: 62,816,408	M1610I	possibly damaging	Het
Tgfbr3	A	T	5: 107,133,003	D630E	probably benign	Het
Thnsl2	T	C	6: 71,134,143	D247G	probably benign	Het
Tmem198b	G	A	10: 128,802,188	R169W	probably benign	Het
Tmem201	G	A	4: 149,727,392	A332V	probably benign	Het
Tsku	T	C	7: 98,352,098	D342G	possibly damaging	Het
Ucn2	A	T	9: 108,986,497	H109L	probably benign	Het
Virma	T	G	4: 11,513,319	L391R	possibly damaging	Het
Vmn1r60	T	A	7: 5,545,099	M1L	probably benign	Het
Vmn2r76	T	C	7: 86,229,934	H386R	probably benign	Het
Zfp608	C	T	18: 54,895,396	R1315Q	probably benign	Het
Zmym2	A	G	14: 56,946,529	T983A	probably benign	Het
Zscan26	A	G	13: 21,445,761	S65P	probably benign	Het

Other mutations in Myo15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00845:Myo15	APN	11	60477779	missense	probably damaging	1.00
IGL01011:Myo15	APN	11	60476992	missense	probably benign	0.33
IGL01100:Myo15	APN	11	60511158	missense	probably damaging	1.00
IGL01357:Myo15	APN	11	60502289	splice site	probably benign
IGL01634:Myo15	APN	11	60495472	missense	probably damaging	1.00
IGL01763:Myo15	APN	11	60521738	missense	probably benign	0.07
IGL01901:Myo15	APN	11	60527434	utr 3 prime	probably benign
IGL01931:Myo15	APN	11	60496138	missense	probably damaging	1.00
IGL02006:Myo15	APN	11	60511128	missense	probably damaging	1.00
IGL02041:Myo15	APN	11	60506863	missense	probably damaging	0.99
IGL02094:Myo15	APN	11	60510647	unclassified	probably benign
IGL02122:Myo15	APN	11	60483466	missense	probably benign	0.23
IGL02153:Myo15	APN	11	60498397	missense	probably damaging	1.00
IGL02328:Myo15	APN	11	60526607	missense	probably benign	0.13
IGL02330:Myo15	APN	11	60477161	missense	possibly damaging	0.94
IGL02431:Myo15	APN	11	60510639	missense	possibly damaging	0.73
IGL02639:Myo15	APN	11	60478621	missense	probably benign
IGL02659:Myo15	APN	11	60491783	splice site	probably benign
IGL02800:Myo15	APN	11	60502369	missense	probably damaging	1.00
IGL02812:Myo15	APN	11	60477179	missense	probably benign	0.15
IGL02863:Myo15	APN	11	60478127	missense	probably damaging	1.00
IGL02873:Myo15	APN	11	60483482	missense	probably damaging	1.00
IGL02990:Myo15	APN	11	60479440	missense	probably benign	0.02
IGL03011:Myo15	APN	11	60509531	splice site	probably benign
IGL03243:Myo15	APN	11	60496518	missense	probably damaging	1.00
IGL03297:Myo15	APN	11	60479141	missense	probably damaging	1.00
parker	UTSW	11	60520914	critical splice donor site	probably null
Typhoon	UTSW	11	60487425	critical splice donor site	probably null
PIT4131001:Myo15	UTSW	11	60483127	missense	probably damaging	1.00
PIT4131001:Myo15	UTSW	11	60495454	missense	probably damaging	1.00
R0133:Myo15	UTSW	11	60477850	missense	possibly damaging	0.94
R0265:Myo15	UTSW	11	60514897	critical splice acceptor site	probably null
R0389:Myo15	UTSW	11	60478538	missense	probably benign
R0416:Myo15	UTSW	11	60511174	missense	probably damaging	1.00
R0449:Myo15	UTSW	11	60509596	missense	possibly damaging	0.92
R0477:Myo15	UTSW	11	60520914	critical splice donor site	probably null
R0543:Myo15	UTSW	11	60479051	missense	probably benign
R0546:Myo15	UTSW	11	60506313	missense	probably damaging	1.00
R0555:Myo15	UTSW	11	60521638	missense	probably damaging	1.00
R0639:Myo15	UTSW	11	60479336	missense	probably benign	0.12
R0723:Myo15	UTSW	11	60478977	missense	possibly damaging	0.94
R0837:Myo15	UTSW	11	60487251	missense	probably damaging	0.98
R0865:Myo15	UTSW	11	60491688	missense	probably damaging	1.00
R0899:Myo15	UTSW	11	60477185	missense	possibly damaging	0.87
R1022:Myo15	UTSW	11	60479616	missense	probably benign	0.00
R1024:Myo15	UTSW	11	60479616	missense	probably benign	0.00
R1035:Myo15	UTSW	11	60510558	unclassified	probably benign
R1109:Myo15	UTSW	11	60493066	missense	probably damaging	1.00
R1170:Myo15	UTSW	11	60479407	missense	probably benign	0.04
R1241:Myo15	UTSW	11	60499430	missense	possibly damaging	0.58
R1392:Myo15	UTSW	11	60477974	missense	possibly damaging	0.95
R1392:Myo15	UTSW	11	60477974	missense	possibly damaging	0.95
R1434:Myo15	UTSW	11	60504331	missense	probably benign	0.00
R1450:Myo15	UTSW	11	60495482	missense	probably damaging	1.00
R1456:Myo15	UTSW	11	60508202	missense	probably damaging	1.00
R1468:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R1468:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R1548:Myo15	UTSW	11	60488238	missense	probably damaging	1.00
R1551:Myo15	UTSW	11	60492965	missense	possibly damaging	0.70
R1571:Myo15	UTSW	11	60518464	missense	probably damaging	1.00
R1662:Myo15	UTSW	11	60501701	missense	probably damaging	1.00
R1777:Myo15	UTSW	11	60514936	missense	probably benign
R1778:Myo15	UTSW	11	60478412	missense	possibly damaging	0.57
R1847:Myo15	UTSW	11	60499495	nonsense	probably null
R1875:Myo15	UTSW	11	60507528	missense	probably damaging	0.99
R1944:Myo15	UTSW	11	60502083	missense	probably damaging	0.99
R1945:Myo15	UTSW	11	60502083	missense	probably damaging	0.99
R2013:Myo15	UTSW	11	60494231	missense	probably damaging	1.00
R2107:Myo15	UTSW	11	60491810	missense	probably damaging	1.00
R2108:Myo15	UTSW	11	60491810	missense	probably damaging	1.00
R2112:Myo15	UTSW	11	60494168	missense	probably damaging	0.99
R2147:Myo15	UTSW	11	60510229	missense	possibly damaging	0.66
R2196:Myo15	UTSW	11	60510021	nonsense	probably null
R2207:Myo15	UTSW	11	60506034	missense	probably benign	0.01
R2245:Myo15	UTSW	11	60509099	missense	probably damaging	1.00
R2367:Myo15	UTSW	11	60517238	missense	probably damaging	0.99
R2374:Myo15	UTSW	11	60478843	missense	possibly damaging	0.88
R2438:Myo15	UTSW	11	60483052	missense	probably damaging	1.00
R3154:Myo15	UTSW	11	60479360	splice site	probably null
R3423:Myo15	UTSW	11	60510300	critical splice donor site	probably null
R3551:Myo15	UTSW	11	60509663	missense	possibly damaging	0.93
R3552:Myo15	UTSW	11	60509663	missense	possibly damaging	0.93
R3612:Myo15	UTSW	11	60477679	missense	probably damaging	1.00
R3620:Myo15	UTSW	11	60478642	missense	possibly damaging	0.63
R3713:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3714:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3715:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3783:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3784:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3785:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3786:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3787:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3894:Myo15	UTSW	11	60504319	missense	probably benign	0.00
R3962:Myo15	UTSW	11	60479828	missense	probably benign	0.00
R4082:Myo15	UTSW	11	60487196	missense	possibly damaging	0.92
R4555:Myo15	UTSW	11	60496937	missense	probably damaging	1.00
R4641:Myo15	UTSW	11	60503041	missense	probably damaging	1.00
R4665:Myo15	UTSW	11	60504879	critical splice acceptor site	probably null
R4713:Myo15	UTSW	11	60479930	missense	probably benign	0.21
R4820:Myo15	UTSW	11	60476915	missense	probably damaging	0.98
R5013:Myo15	UTSW	11	60491667	missense	probably damaging	1.00
R5051:Myo15	UTSW	11	60487425	critical splice donor site	probably null
R5187:Myo15	UTSW	11	60503614	missense	probably damaging	1.00
R5230:Myo15	UTSW	11	60502848	missense	possibly damaging	0.68
R5277:Myo15	UTSW	11	60477114	nonsense	probably null
R5345:Myo15	UTSW	11	60497538	missense	probably damaging	0.99
R5349:Myo15	UTSW	11	60493583	missense	probably damaging	1.00
R5356:Myo15	UTSW	11	60498366	missense	probably damaging	1.00
R5445:Myo15	UTSW	11	60520777	nonsense	probably null
R5477:Myo15	UTSW	11	60477677	missense	probably damaging	1.00
R5629:Myo15	UTSW	11	60479752	missense	probably benign
R5728:Myo15	UTSW	11	60488896	missense	probably damaging	1.00
R5952:Myo15	UTSW	11	60479420	missense	possibly damaging	0.50
R6338:Myo15	UTSW	11	60478133	missense	probably damaging	0.99
R6467:Myo15	UTSW	11	60526661	critical splice donor site	probably null
R6488:Myo15	UTSW	11	60478487	missense	possibly damaging	0.86
R6521:Myo15	UTSW	11	60502369	missense	probably damaging	1.00
R6645:Myo15	UTSW	11	60477292	missense	probably benign	0.00
R6702:Myo15	UTSW	11	60492992	missense	probably benign	0.16
R6703:Myo15	UTSW	11	60492992	missense	probably benign	0.16
R6821:Myo15	UTSW	11	60524475	missense	probably damaging	1.00
R6882:Myo15	UTSW	11	60524006	missense	probably damaging	1.00
R6908:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R6932:Myo15	UTSW	11	60499494	missense	probably damaging	1.00
R6958:Myo15	UTSW	11	60503625	missense	probably benign	0.07
R7041:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R7149:Myo15	UTSW	11	60510010	missense	possibly damaging	0.56
R7163:Myo15	UTSW	11	60498369	missense
R7229:Myo15	UTSW	11	60496495	missense	probably benign	0.08
R7347:Myo15	UTSW	11	60477961	missense	probably benign
R7368:Myo15	UTSW	11	60490915	splice site	probably null
R7392:Myo15	UTSW	11	60505976	missense
R7414:Myo15	UTSW	11	60483483	missense
R7461:Myo15	UTSW	11	60505152	missense
R7609:Myo15	UTSW	11	60488811	missense
R7613:Myo15	UTSW	11	60505152	missense
R7734:Myo15	UTSW	11	60510282	missense	probably benign
R7748:Myo15	UTSW	11	60504901	missense
R7767:Myo15	UTSW	11	60502096	missense
R7769:Myo15	UTSW	11	60509149	missense
R7894:Myo15	UTSW	11	60491137	missense
R7919:Myo15	UTSW	11	60526530	missense	probably damaging	1.00
R8100:Myo15	UTSW	11	60517190	missense	probably damaging	1.00
R8124:Myo15	UTSW	11	60507453	missense
R8129:Myo15	UTSW	11	60508200	missense
R8428:Myo15	UTSW	11	60496415	missense	probably damaging	1.00
X0021:Myo15	UTSW	11	60482359	nonsense	probably null
X0066:Myo15	UTSW	11	60478220	missense	probably damaging	1.00
X0067:Myo15	UTSW	11	60478618	missense	possibly damaging	0.88
Z1176:Myo15	UTSW	11	60488258	missense
Z1176:Myo15	UTSW	11	60498403	missense
Z1176:Myo15	UTSW	11	60524441	missense	probably damaging	1.00
Z1177:Myo15	UTSW	11	60477523	missense	probably damaging	1.00
Z1177:Myo15	UTSW	11	60488837	missense
Z1177:Myo15	UTSW	11	60495475	missense

Predicted Primers

PCR Primer
(F):5'- CAGGTGTGTTGTCATCTCTAACATG -3'
(R):5'- TCTTGTACGACAGGGCACAG -3'

Sequencing Primer
(F):5'- TCATCTCTAACATGGGGGAGG -3'
(R):5'- GAGTGCTGTGTCACCTCCTAG -3'

Posted On

2016-12-20