Incidental Mutation 'R5818:Dgat1'
ID449189
Institutional Source Beutler Lab
Gene Symbol Dgat1
Ensembl Gene ENSMUSG00000022555
Gene Namediacylglycerol O-acyltransferase 1
SynonymsD15Ertd23e
MMRRC Submission 043398-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.604) question?
Stock #R5818 (G1)
Quality Score213
Status Validated
Chromosome15
Chromosomal Location76502015-76511953 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 76502207 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023214] [ENSMUST00000072838] [ENSMUST00000226860] [ENSMUST00000226872] [ENSMUST00000227478] [ENSMUST00000228371] [ENSMUST00000228757] [ENSMUST00000228868] [ENSMUST00000229363]
Predicted Effect probably benign
Transcript: ENSMUST00000023214
SMART Domains Protein: ENSMUSP00000023214
Gene: ENSMUSG00000022555

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
low complexity region 41 57 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
Pfam:MBOAT 162 485 8.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072838
SMART Domains Protein: ENSMUSP00000072617
Gene: ENSMUSG00000022556

DomainStartEndE-ValueType
HSF 14 118 2.27e-66 SMART
Pfam:Vert_HS_TF 247 414 6e-65 PFAM
Pfam:Vert_HS_TF 412 503 1.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160293
SMART Domains Protein: ENSMUSP00000123779
Gene: ENSMUSG00000022555

DomainStartEndE-ValueType
Pfam:MBOAT 41 201 4.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162813
Predicted Effect probably benign
Transcript: ENSMUST00000226238
Predicted Effect probably benign
Transcript: ENSMUST00000226860
Predicted Effect probably benign
Transcript: ENSMUST00000226872
Predicted Effect probably benign
Transcript: ENSMUST00000227478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227921
Predicted Effect probably benign
Transcript: ENSMUST00000228371
Predicted Effect probably benign
Transcript: ENSMUST00000228688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228720
Predicted Effect probably benign
Transcript: ENSMUST00000228757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228781
Predicted Effect probably benign
Transcript: ENSMUST00000228868
Predicted Effect probably benign
Transcript: ENSMUST00000229363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231035
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an multipass transmembrane protein that functions as a key metabolic enzyme. The encoded protein catalyzes the conversion of diacylglycerol and fatty acyl CoA to triacylglycerol. This enzyme can also transfer acyl CoA to retinol. Activity of this protein may be associated with obesity and other metabolic diseases. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to decreased percent body fat, resistance to diet-induced obesity, altered energy, glucose and triglyceride metabolism, alopecia, hair cycle and skin defects, and a lactation failure associated with impaired mammary gland growth during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,643 V560D probably damaging Het
Actn4 A G 7: 28,919,019 I72T probably damaging Het
Adam33 A T 2: 131,054,358 C440S possibly damaging Het
Bace1 T C 9: 45,859,049 I361T possibly damaging Het
Bend6 T C 1: 33,883,573 probably benign Het
Bpifb9a T G 2: 154,262,295 N219K probably damaging Het
Cacna1g C A 11: 94,418,120 K1634N probably damaging Het
Ccdc155 C T 7: 45,193,959 probably null Het
Cdk18 A G 1: 132,119,098 probably null Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Corin G T 5: 72,435,395 H87N probably benign Het
Cps1 A T 1: 67,166,488 I557F possibly damaging Het
Cyp4a29 T C 4: 115,247,032 V99A possibly damaging Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Fbxw26 G T 9: 109,732,566 R187S probably benign Het
Gabrd G A 4: 155,388,361 P122S probably damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm8300 T G 12: 87,517,060 V55G possibly damaging Het
Hif1a A G 12: 73,939,564 Q343R possibly damaging Het
Hyou1 G A 9: 44,388,926 probably null Het
Igfn1 A T 1: 135,966,126 I2072K possibly damaging Het
Kctd8 C T 5: 69,296,711 A328T probably benign Het
Krt10 A G 11: 99,388,771 Y188H probably damaging Het
Krtap4-16 T A 11: 99,851,523 Q17L unknown Het
Larp4b T A 13: 9,158,560 S416R probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Mroh4 A G 15: 74,611,982 I571T probably damaging Het
Myo15 G A 11: 60,497,951 R2021Q probably benign Het
Npl G A 1: 153,535,915 R63C probably damaging Het
Ntn4 A G 10: 93,644,764 I80V probably benign Het
Numb C T 12: 83,825,254 probably null Het
Nusap1 A C 2: 119,635,513 M205L possibly damaging Het
Olfr149 T C 9: 39,702,365 S135G probably benign Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Pmfbp1 T C 8: 109,538,679 probably null Het
Ppfia1 T C 7: 144,520,568 probably benign Het
Ppm1b A G 17: 84,993,719 K9R probably benign Het
Rab11fip3 T C 17: 26,016,116 S608G probably damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Sohlh2 A G 3: 55,190,501 T125A probably damaging Het
Ssfa2 T A 2: 79,644,593 S299T probably damaging Het
Tet1 C A 10: 62,816,408 M1610I possibly damaging Het
Tgfbr3 A T 5: 107,133,003 D630E probably benign Het
Thnsl2 T C 6: 71,134,143 D247G probably benign Het
Tmem198b G A 10: 128,802,188 R169W probably benign Het
Tmem201 G A 4: 149,727,392 A332V probably benign Het
Tsku T C 7: 98,352,098 D342G possibly damaging Het
Ucn2 A T 9: 108,986,497 H109L probably benign Het
Virma T G 4: 11,513,319 L391R possibly damaging Het
Vmn1r60 T A 7: 5,545,099 M1L probably benign Het
Vmn2r76 T C 7: 86,229,934 H386R probably benign Het
Zfp608 C T 18: 54,895,396 R1315Q probably benign Het
Zmym2 A G 14: 56,946,529 T983A probably benign Het
Zscan26 A G 13: 21,445,761 S65P probably benign Het
Other mutations in Dgat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Dgat1 APN 15 76503041 missense probably damaging 1.00
IGL02713:Dgat1 APN 15 76503534 missense probably damaging 1.00
R0510:Dgat1 UTSW 15 76511567 missense possibly damaging 0.85
R0894:Dgat1 UTSW 15 76502999 missense possibly damaging 0.55
R1525:Dgat1 UTSW 15 76511586 missense probably benign
R1682:Dgat1 UTSW 15 76503019 missense probably benign 0.03
R1740:Dgat1 UTSW 15 76502729 missense probably damaging 1.00
R1817:Dgat1 UTSW 15 76502503 missense probably damaging 1.00
R2352:Dgat1 UTSW 15 76502313 missense possibly damaging 0.66
R3012:Dgat1 UTSW 15 76503393 missense possibly damaging 0.90
R3154:Dgat1 UTSW 15 76502521 missense probably benign 0.27
R4059:Dgat1 UTSW 15 76504171 missense possibly damaging 0.79
R4593:Dgat1 UTSW 15 76504689 missense probably damaging 1.00
R5503:Dgat1 UTSW 15 76502194 unclassified probably benign
R5984:Dgat1 UTSW 15 76502258 missense probably damaging 1.00
R6228:Dgat1 UTSW 15 76503293 missense possibly damaging 0.89
R7352:Dgat1 UTSW 15 76502824 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAACCCCTGCAAGAAGGTTTTAG -3'
(R):5'- CATGTGTTCTCAGGTCCCACTG -3'

Sequencing Primer
(F):5'- CCCTGCAAGAAGGTTTTAGACAGC -3'
(R):5'- TCCCACTGGCCTGGATTGTG -3'
Posted On2016-12-20