Incidental Mutation 'R5819:Optc'
ID449198
Institutional Source Beutler Lab
Gene Symbol Optc
Ensembl Gene ENSMUSG00000010311
Gene Nameopticin
Synonyms
MMRRC Submission 043399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5819 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location133897199-133907999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133897879 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 303 (D303G)
Ref Sequence ENSEMBL: ENSMUSP00000123262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124051] [ENSMUST00000149380] [ENSMUST00000153617]
Predicted Effect probably damaging
Transcript: ENSMUST00000124051
AA Change: D356G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120568
Gene: ENSMUSG00000010311
AA Change: D356G

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRRNT 176 206 2.22e-2 SMART
LRR 200 224 3.55e1 SMART
LRR_TYP 225 248 6.78e-3 SMART
LRR 249 271 4.21e1 SMART
LRR 295 318 1.76e1 SMART
LRR 319 339 3.36e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124245
Predicted Effect probably benign
Transcript: ENSMUST00000126123
SMART Domains Protein: ENSMUSP00000117086
Gene: ENSMUSG00000010311

DomainStartEndE-ValueType
low complexity region 32 60 N/A INTRINSIC
low complexity region 68 78 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
LRRNT 166 196 2.22e-2 SMART
LRR 190 214 3.55e1 SMART
LRR_TYP 215 238 6.78e-3 SMART
LRR 239 261 4.21e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149380
AA Change: D303G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115661
Gene: ENSMUSG00000010311
AA Change: D303G

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRR 173 195 1.22e1 SMART
LRR 196 218 4.21e1 SMART
LRR 242 265 1.76e1 SMART
LRR 266 286 3.36e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153617
AA Change: D303G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123262
Gene: ENSMUSG00000010311
AA Change: D303G

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRR 173 195 1.22e1 SMART
LRR 196 218 4.21e1 SMART
LRR 242 265 1.76e1 SMART
LRR 266 286 3.36e1 SMART
Meta Mutation Damage Score 0.2084 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opticin belongs to class III of the small leucine-rich repeat protein (SLRP) family. Members of this family are typically associated with the extracellular matrix. Opticin is present in significant quantities in the vitreous of the eye and also localizes to the cornea, iris, ciliary body, optic nerve, choroid, retina, and fetal liver. Opticin may noncovalently bind collagen fibrils and regulate fibril morphology, spacing, and organization. The opticin gene is mapped to a region of chromosome 1 that is associated with the inherited eye diseases age-related macular degeneration (AMD) and posterior column ataxia with retinosa pigmentosa (AXPC1). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased preretinal neovascularization in an oxygen-induced retinopathy model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Optc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Optc APN 1 133902108 missense probably damaging 1.00
IGL01900:Optc APN 1 133902129 missense possibly damaging 0.68
IGL01988:Optc APN 1 133906929 critical splice donor site probably null
IGL02070:Optc APN 1 133901176 missense probably damaging 1.00
IGL02859:Optc APN 1 133902061 missense probably damaging 1.00
IGL03166:Optc APN 1 133903792 splice site probably benign
R0826:Optc UTSW 1 133905155 missense probably benign 0.07
R1728:Optc UTSW 1 133903796 splice site probably null
R1728:Optc UTSW 1 133905170 missense probably benign
R1729:Optc UTSW 1 133903796 splice site probably null
R1729:Optc UTSW 1 133905170 missense probably benign
R1730:Optc UTSW 1 133903796 splice site probably null
R1730:Optc UTSW 1 133905170 missense probably benign
R1739:Optc UTSW 1 133903796 splice site probably null
R1739:Optc UTSW 1 133905170 missense probably benign
R1762:Optc UTSW 1 133903796 splice site probably null
R1762:Optc UTSW 1 133905170 missense probably benign
R1783:Optc UTSW 1 133903796 splice site probably null
R1783:Optc UTSW 1 133905170 missense probably benign
R1784:Optc UTSW 1 133903796 splice site probably null
R1784:Optc UTSW 1 133905170 missense probably benign
R1785:Optc UTSW 1 133903796 splice site probably null
R1785:Optc UTSW 1 133905170 missense probably benign
R2049:Optc UTSW 1 133903796 splice site probably null
R2130:Optc UTSW 1 133903796 splice site probably null
R2131:Optc UTSW 1 133903796 splice site probably null
R2133:Optc UTSW 1 133903796 splice site probably null
R2141:Optc UTSW 1 133903796 splice site probably null
R2142:Optc UTSW 1 133903796 splice site probably null
R3436:Optc UTSW 1 133897879 missense probably damaging 1.00
R3437:Optc UTSW 1 133897879 missense probably damaging 1.00
R3711:Optc UTSW 1 133905081 missense probably benign 0.15
R3902:Optc UTSW 1 133897963 missense probably benign 0.10
R3930:Optc UTSW 1 133901182 nonsense probably null
R4078:Optc UTSW 1 133898349 missense probably damaging 1.00
R4523:Optc UTSW 1 133903754 missense possibly damaging 0.94
R4672:Optc UTSW 1 133897817 missense possibly damaging 0.48
R5113:Optc UTSW 1 133900977 splice site probably benign
R5176:Optc UTSW 1 133902084 missense probably benign 0.00
R5530:Optc UTSW 1 133905090 missense probably benign 0.01
R5692:Optc UTSW 1 133900976 splice site probably benign
R6208:Optc UTSW 1 133904999 missense probably damaging 1.00
R6828:Optc UTSW 1 133897867 missense probably damaging 1.00
R6859:Optc UTSW 1 133897816 missense possibly damaging 0.95
R6986:Optc UTSW 1 133897964 missense probably benign 0.00
R7349:Optc UTSW 1 133897879 missense probably damaging 1.00
R7754:Optc UTSW 1 133906992 missense possibly damaging 0.73
R8270:Optc UTSW 1 133905072 missense probably benign 0.02
X0025:Optc UTSW 1 133897911 missense probably damaging 1.00
Z1177:Optc UTSW 1 133901085 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GGAACTTGGGCTACAGATGAC -3'
(R):5'- GCCATGGAAGTGATGTTCTCC -3'

Sequencing Primer
(F):5'- AACTTGGGCTACAGATGACTTTCTG -3'
(R):5'- ATGGAAGTGATGTTCTCCACTCC -3'
Posted On2016-12-20