Incidental Mutation 'R5819:Pjvk'
ID449201
Institutional Source Beutler Lab
Gene Symbol Pjvk
Ensembl Gene ENSMUSG00000075267
Gene Namepejvakin
Synonymspejvakin, Dfnb59, LOC381375
MMRRC Submission 043399-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5819 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location76648476-76658556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76658369 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 295 (I295V)
Ref Sequence ENSEMBL: ENSMUSP00000097566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002809] [ENSMUST00000099986] [ENSMUST00000144817]
Predicted Effect probably benign
Transcript: ENSMUST00000002809
SMART Domains Protein: ENSMUSP00000002809
Gene: ENSMUSG00000002732

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:FKBP_C 42 138 7e-31 PFAM
EFh 145 173 1.83e1 SMART
EFh 189 217 5.38e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099986
AA Change: I295V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097566
Gene: ENSMUSG00000075267
AA Change: I295V

DomainStartEndE-ValueType
Pfam:Gasdermin 1 278 7.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144817
SMART Domains Protein: ENSMUSP00000119264
Gene: ENSMUSG00000075267

DomainStartEndE-ValueType
Pfam:Gasdermin 1 184 2.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154097
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gasdermin family, a family which is found only in vertebrates. The encoded protein is required for the proper function of auditory pathway neurons. Defects in this gene are a cause of non-syndromic sensorineural deafness autosomal recessive type 59 (DFNB59). [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a point mutation display increased auditory thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Pjvk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01797:Pjvk APN 2 76657539 unclassified probably benign
IGL01805:Pjvk APN 2 76657514 missense probably benign 0.11
IGL01821:Pjvk APN 2 76655915 missense probably damaging 0.96
IGL02850:Pjvk APN 2 76658451 missense possibly damaging 0.85
R1757:Pjvk UTSW 2 76655888 missense probably benign
R1851:Pjvk UTSW 2 76657431 critical splice acceptor site probably null
R2152:Pjvk UTSW 2 76658369 missense probably benign 0.10
R2265:Pjvk UTSW 2 76657453 missense possibly damaging 0.84
R4439:Pjvk UTSW 2 76651406 missense probably damaging 1.00
R5207:Pjvk UTSW 2 76650390 critical splice acceptor site probably null
R5381:Pjvk UTSW 2 76651560 splice site probably null
R6165:Pjvk UTSW 2 76650218 splice site probably null
R7148:Pjvk UTSW 2 76658487 missense possibly damaging 0.86
R7559:Pjvk UTSW 2 76655810 missense probably benign 0.07
R7573:Pjvk UTSW 2 76657465 missense probably benign 0.03
R7772:Pjvk UTSW 2 76657533 critical splice donor site probably null
X0026:Pjvk UTSW 2 76650534 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGCCCAGTTGTTTCCTGAC -3'
(R):5'- GCGCACAAAGCATATTCCTTC -3'

Sequencing Primer
(F):5'- CACCTATATAAACAGTTTGGGGTGC -3'
(R):5'- TCCTTTTATTTCATTCTCTTGTGCC -3'
Posted On2016-12-20