Mutagenetix > Incidental Mutation

Incidental Mutation 'R5819:4932438A13Rik'

449205

Institutional Source

Beutler Lab

Gene Symbol

4932438A13Rik

Ensembl Gene

ENSMUSG00000037270

Gene Name

RIKEN cDNA 4932438A13 gene

Synonyms

Tweek, FSA

MMRRC Submission

043399-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5819 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36863104-37053033 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37048600 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 4863 (M4863L)

Ref Sequence

ENSEMBL: ENSMUSP00000117808 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000138950] [ENSMUST00000152564]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000057272
AA Change: M4863L

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270
AA Change: M4863L

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126099

Predicted Effect

probably benign
Transcript: ENSMUST00000138950
AA Change: M1365L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000118092
Gene: ENSMUSG00000037270
AA Change: M1365L

Domain	Start	End	E-Value	Type
low complexity region	254	279	N/A	INTRINSIC
low complexity region	353	374	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	543	551	N/A	INTRINSIC
low complexity region	619	651	N/A	INTRINSIC
low complexity region	674	687	N/A	INTRINSIC
low complexity region	861	882	N/A	INTRINSIC
FSA_C	888	1492	N/A	SMART
low complexity region	1495	1506	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139667

Predicted Effect

unknown
Transcript: ENSMUST00000141740
AA Change: M1443L

SMART Domains

Protein: ENSMUSP00000117814
Gene: ENSMUSG00000037270
AA Change: M1443L

Domain	Start	End	E-Value	Type
low complexity region	28	40	N/A	INTRINSIC
low complexity region	298	323	N/A	INTRINSIC
low complexity region	397	418	N/A	INTRINSIC
low complexity region	500	510	N/A	INTRINSIC
low complexity region	522	529	N/A	INTRINSIC
low complexity region	605	619	N/A	INTRINSIC
low complexity region	622	630	N/A	INTRINSIC
low complexity region	698	730	N/A	INTRINSIC
low complexity region	753	766	N/A	INTRINSIC
low complexity region	940	961	N/A	INTRINSIC
FSA_C	967	1571	N/A	SMART
low complexity region	1574	1585	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000146948
AA Change: M1568L

SMART Domains

Protein: ENSMUSP00000121356
Gene: ENSMUSG00000037270
AA Change: M1568L

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	167	177	N/A	INTRINSIC
low complexity region	458	483	N/A	INTRINSIC
low complexity region	557	578	N/A	INTRINSIC
low complexity region	730	744	N/A	INTRINSIC
low complexity region	747	755	N/A	INTRINSIC
low complexity region	823	855	N/A	INTRINSIC
low complexity region	878	891	N/A	INTRINSIC
low complexity region	1065	1086	N/A	INTRINSIC
FSA_C	1092	1696	N/A	SMART
low complexity region	1699	1710	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152564
AA Change: M4863L

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270
AA Change: M4863L

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196036

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	T	3: 122,136,981 (GRCm38)	I1376F	probably damaging	Het
Aggf1	T	C	13: 95,351,621 (GRCm38)	N673D	possibly damaging	Het
Avil	T	C	10: 127,009,998 (GRCm38)	F372S	probably damaging	Het
Bod1l	T	A	5: 41,832,605 (GRCm38)	E258D	probably benign	Het
Ccdc129	A	T	6: 55,897,891 (GRCm38)	K275N	probably benign	Het
Chek1	T	A	9: 36,710,405 (GRCm38)	H420L	probably benign	Het
Cyfip1	A	G	7: 55,879,151 (GRCm38)	I260M	probably damaging	Het
Dclk1	G	A	3: 55,489,864 (GRCm38)	V524I	probably damaging	Het
Efr3b	T	C	12: 3,992,965 (GRCm38)	M102V	probably benign	Het
Erc2	T	A	14: 28,141,369 (GRCm38)	I517N	probably damaging	Het
Fubp1	T	C	3: 152,220,553 (GRCm38)	I305T	probably damaging	Het
Galc	T	A	12: 98,216,261 (GRCm38)	D443V	probably benign	Het
Galnt4	T	A	10: 99,110,030 (GRCm38)	I539N	probably damaging	Het
Gm17093	G	T	14: 44,521,529 (GRCm38)	M169I	unknown	Het
Gm4858	A	G	3: 93,073,732 (GRCm38)	Y19C	probably damaging	Het
Htra1	T	C	7: 130,981,739 (GRCm38)	F363S	probably damaging	Het
Klhdc8b	G	A	9: 108,451,062 (GRCm38)	P64S	probably benign	Het
Kmt2c	A	G	5: 25,409,132 (GRCm38)		probably null	Het
Mettl21c	T	G	1: 44,009,722 (GRCm38)	K222Q	probably damaging	Het
Mga	A	C	2: 119,941,263 (GRCm38)	M1535L	possibly damaging	Het
Mov10	C	T	3: 104,801,512 (GRCm38)	G395D	probably damaging	Het
Ms4a10	C	A	19: 10,968,690 (GRCm38)	A26S	probably benign	Het
Naaladl1	A	G	19: 6,109,654 (GRCm38)	N372D	possibly damaging	Het
Olfr1275	A	T	2: 111,230,959 (GRCm38)	I278N	probably damaging	Het
Optc	T	C	1: 133,897,879 (GRCm38)	D303G	probably damaging	Het
Osmr	C	A	15: 6,815,787 (GRCm38)	V833L	probably benign	Het
Phf14	A	G	6: 11,997,252 (GRCm38)		probably null	Het
Pjvk	A	G	2: 76,658,369 (GRCm38)	I295V	probably benign	Het
Plppr4	T	A	3: 117,325,864 (GRCm38)	I299L	possibly damaging	Het
Prkg1	A	G	19: 31,585,672 (GRCm38)	S110P	probably benign	Het
Ptprq	T	A	10: 107,719,883 (GRCm38)		probably benign	Het
Rarb	T	G	14: 16,443,820 (GRCm38)	N156T	possibly damaging	Het
Rgl3	A	T	9: 21,981,602 (GRCm38)		probably null	Het
Ruvbl1	A	C	6: 88,483,115 (GRCm38)		probably null	Het
S1pr1	G	T	3: 115,712,140 (GRCm38)	C268*	probably null	Het
Sbk3	T	C	7: 4,969,997 (GRCm38)	D58G	probably benign	Het
Scgb2b3	T	A	7: 31,360,214 (GRCm38)	H45L	possibly damaging	Het
Smim8	TTTAATGAAGAGCT	TT	4: 34,771,261 (GRCm38)		probably benign	Het
Soga3	A	T	10: 29,197,273 (GRCm38)	M854L	probably benign	Het
Tas2r119	T	C	15: 32,177,306 (GRCm38)	L6P	probably damaging	Het
Tcp11	A	T	17: 28,069,236 (GRCm38)	F339L	probably damaging	Het
Tmprss5	T	A	9: 49,114,479 (GRCm38)		probably null	Het
Trnau1ap	A	G	4: 132,325,210 (GRCm38)		probably benign	Het
Trp53bp1	G	A	2: 121,208,392 (GRCm38)	R1397*	probably null	Het
Ubqln3	G	A	7: 104,141,467 (GRCm38)	P472L	probably benign	Het
Vmn2r13	T	A	5: 109,174,100 (GRCm38)	M244L	possibly damaging	Het
Zfp777	C	T	6: 48,037,588 (GRCm38)	E395K	probably damaging	Het
Zfyve27	A	G	19: 42,183,496 (GRCm38)	S156G	probably benign	Het

Other mutations in 4932438A13Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:4932438A13Rik	APN	3	37,011,727 (GRCm38)	missense	probably benign	0.00
IGL00434:4932438A13Rik	APN	3	36,987,299 (GRCm38)	missense	probably damaging	0.98
IGL00640:4932438A13Rik	APN	3	36,908,218 (GRCm38)	missense	probably damaging	1.00
IGL00693:4932438A13Rik	APN	3	37,052,547 (GRCm38)	utr 3 prime	probably benign
IGL00721:4932438A13Rik	APN	3	37,030,751 (GRCm38)	splice site	probably null
IGL00756:4932438A13Rik	APN	3	36,908,218 (GRCm38)	missense	probably damaging	1.00
IGL00896:4932438A13Rik	APN	3	37,039,462 (GRCm38)	missense	probably benign
IGL00902:4932438A13Rik	APN	3	37,041,345 (GRCm38)	missense	probably damaging	1.00
IGL00980:4932438A13Rik	APN	3	37,000,041 (GRCm38)	missense	probably damaging	1.00
IGL01019:4932438A13Rik	APN	3	37,006,984 (GRCm38)	critical splice acceptor site	probably null
IGL01025:4932438A13Rik	APN	3	37,046,280 (GRCm38)	missense	possibly damaging	0.89
IGL01306:4932438A13Rik	APN	3	37,005,013 (GRCm38)	splice site	probably benign
IGL01370:4932438A13Rik	APN	3	36,947,755 (GRCm38)	missense	probably benign	0.07
IGL01377:4932438A13Rik	APN	3	36,973,452 (GRCm38)	critical splice donor site	probably null
IGL01401:4932438A13Rik	APN	3	36,942,292 (GRCm38)	missense	probably benign
IGL01419:4932438A13Rik	APN	3	37,048,121 (GRCm38)	missense	probably damaging	1.00
IGL01432:4932438A13Rik	APN	3	37,003,759 (GRCm38)	missense	possibly damaging	0.87
IGL01433:4932438A13Rik	APN	3	36,887,770 (GRCm38)	missense	probably damaging	1.00
IGL01452:4932438A13Rik	APN	3	36,996,308 (GRCm38)	unclassified	probably benign
IGL01520:4932438A13Rik	APN	3	36,973,260 (GRCm38)	nonsense	probably null
IGL01524:4932438A13Rik	APN	3	36,942,382 (GRCm38)	missense	possibly damaging	0.90
IGL01628:4932438A13Rik	APN	3	37,008,485 (GRCm38)	missense	probably damaging	1.00
IGL01638:4932438A13Rik	APN	3	36,974,311 (GRCm38)	missense	probably damaging	1.00
IGL01650:4932438A13Rik	APN	3	36,992,673 (GRCm38)	splice site	probably benign
IGL01717:4932438A13Rik	APN	3	37,034,736 (GRCm38)	missense	probably benign
IGL01767:4932438A13Rik	APN	3	37,041,363 (GRCm38)	missense	probably benign	0.29
IGL01813:4932438A13Rik	APN	3	36,928,520 (GRCm38)	missense	possibly damaging	0.90
IGL01998:4932438A13Rik	APN	3	36,957,016 (GRCm38)	missense	possibly damaging	0.49
IGL02172:4932438A13Rik	APN	3	37,004,873 (GRCm38)	missense	probably damaging	0.99
IGL02197:4932438A13Rik	APN	3	36,906,735 (GRCm38)	missense	probably damaging	1.00
IGL02248:4932438A13Rik	APN	3	36,969,290 (GRCm38)	critical splice donor site	probably null
IGL02273:4932438A13Rik	APN	3	36,921,437 (GRCm38)	splice site	probably benign
IGL02403:4932438A13Rik	APN	3	37,030,664 (GRCm38)	missense	probably benign
IGL02492:4932438A13Rik	APN	3	37,048,113 (GRCm38)	missense	probably benign	0.04
IGL02517:4932438A13Rik	APN	3	36,958,868 (GRCm38)	missense	probably damaging	1.00
IGL02519:4932438A13Rik	APN	3	36,895,315 (GRCm38)	missense	probably damaging	1.00
IGL02586:4932438A13Rik	APN	3	37,044,608 (GRCm38)	nonsense	probably null
IGL02620:4932438A13Rik	APN	3	37,035,945 (GRCm38)	missense	possibly damaging	0.95
IGL02621:4932438A13Rik	APN	3	37,041,484 (GRCm38)	splice site	probably benign
IGL02670:4932438A13Rik	APN	3	36,967,305 (GRCm38)	nonsense	probably null
IGL02806:4932438A13Rik	APN	3	36,946,494 (GRCm38)	missense	possibly damaging	0.95
IGL02985:4932438A13Rik	APN	3	36,958,757 (GRCm38)	missense	probably damaging	0.99
IGL03004:4932438A13Rik	APN	3	36,965,677 (GRCm38)	splice site	probably benign
IGL03037:4932438A13Rik	APN	3	36,969,207 (GRCm38)	missense	probably benign	0.23
IGL03037:4932438A13Rik	APN	3	36,969,208 (GRCm38)	missense	probably damaging	1.00
IGL03062:4932438A13Rik	APN	3	37,038,517 (GRCm38)	splice site	probably benign
IGL03137:4932438A13Rik	APN	3	37,034,602 (GRCm38)	missense	probably damaging	0.98
IGL03150:4932438A13Rik	APN	3	36,948,066 (GRCm38)	missense	probably damaging	1.00
IGL03204:4932438A13Rik	APN	3	37,050,934 (GRCm38)	splice site	probably benign
IGL03207:4932438A13Rik	APN	3	36,949,996 (GRCm38)	missense	possibly damaging	0.73
IGL03256:4932438A13Rik	APN	3	36,906,683 (GRCm38)	splice site	probably benign
IGL03264:4932438A13Rik	APN	3	37,002,635 (GRCm38)	missense	probably damaging	1.00
IGL03265:4932438A13Rik	APN	3	37,047,991 (GRCm38)	missense	probably benign	0.00
IGL03303:4932438A13Rik	APN	3	36,870,077 (GRCm38)	missense	possibly damaging	0.90
admonished	UTSW	3	36,948,304 (GRCm38)	missense	probably damaging	1.00
alerted	UTSW	3	37,033,265 (GRCm38)	missense	possibly damaging	0.85
informed	UTSW	3	36,965,849 (GRCm38)	missense	probably damaging	1.00
resolved	UTSW	3	36,921,221 (GRCm38)	missense	possibly damaging	0.60
tipped	UTSW	3	36,988,085 (GRCm38)	missense	possibly damaging	0.81
warned	UTSW	3	36,965,621 (GRCm38)	missense	probably damaging	1.00
FR4340:4932438A13Rik	UTSW	3	37,050,752 (GRCm38)	critical splice acceptor site	probably benign
FR4737:4932438A13Rik	UTSW	3	37,050,754 (GRCm38)	critical splice acceptor site	probably benign
PIT4515001:4932438A13Rik	UTSW	3	36,974,236 (GRCm38)	missense	probably damaging	1.00
R0035:4932438A13Rik	UTSW	3	36,987,598 (GRCm38)	nonsense	probably null
R0047:4932438A13Rik	UTSW	3	36,908,192 (GRCm38)	missense	possibly damaging	0.83
R0047:4932438A13Rik	UTSW	3	36,908,192 (GRCm38)	missense	possibly damaging	0.83
R0068:4932438A13Rik	UTSW	3	36,952,221 (GRCm38)	missense	probably benign	0.28
R0068:4932438A13Rik	UTSW	3	36,952,221 (GRCm38)	missense	probably benign	0.28
R0092:4932438A13Rik	UTSW	3	37,028,159 (GRCm38)	missense	probably benign	0.41
R0233:4932438A13Rik	UTSW	3	36,948,563 (GRCm38)	nonsense	probably null
R0233:4932438A13Rik	UTSW	3	36,948,563 (GRCm38)	nonsense	probably null
R0256:4932438A13Rik	UTSW	3	36,917,773 (GRCm38)	missense	probably benign	0.01
R0277:4932438A13Rik	UTSW	3	36,943,182 (GRCm38)	nonsense	probably null
R0321:4932438A13Rik	UTSW	3	36,906,788 (GRCm38)	splice site	probably null
R0323:4932438A13Rik	UTSW	3	36,943,182 (GRCm38)	nonsense	probably null
R0335:4932438A13Rik	UTSW	3	36,969,152 (GRCm38)	missense	probably damaging	1.00
R0375:4932438A13Rik	UTSW	3	37,046,252 (GRCm38)	missense	probably damaging	0.99
R0437:4932438A13Rik	UTSW	3	36,989,804 (GRCm38)	missense	possibly damaging	0.81
R0445:4932438A13Rik	UTSW	3	37,000,065 (GRCm38)	missense	probably damaging	0.99
R0496:4932438A13Rik	UTSW	3	36,987,635 (GRCm38)	missense	probably damaging	1.00
R0531:4932438A13Rik	UTSW	3	37,036,825 (GRCm38)	missense	probably damaging	1.00
R0543:4932438A13Rik	UTSW	3	36,996,458 (GRCm38)	missense	probably benign	0.22
R0545:4932438A13Rik	UTSW	3	36,987,690 (GRCm38)	splice site	probably benign
R0674:4932438A13Rik	UTSW	3	37,044,626 (GRCm38)	missense	possibly damaging	0.86
R0745:4932438A13Rik	UTSW	3	36,928,463 (GRCm38)	missense	probably damaging	1.00
R0755:4932438A13Rik	UTSW	3	36,946,364 (GRCm38)	missense	probably damaging	1.00
R0785:4932438A13Rik	UTSW	3	36,959,334 (GRCm38)	splice site	probably benign
R1056:4932438A13Rik	UTSW	3	37,044,680 (GRCm38)	missense	probably benign	0.44
R1056:4932438A13Rik	UTSW	3	36,983,453 (GRCm38)	missense	possibly damaging	0.69
R1080:4932438A13Rik	UTSW	3	36,988,255 (GRCm38)	missense	probably damaging	1.00
R1103:4932438A13Rik	UTSW	3	36,996,523 (GRCm38)	missense	probably benign
R1119:4932438A13Rik	UTSW	3	36,987,045 (GRCm38)	missense	probably damaging	1.00
R1170:4932438A13Rik	UTSW	3	37,044,631 (GRCm38)	missense	probably damaging	0.98
R1183:4932438A13Rik	UTSW	3	36,895,303 (GRCm38)	missense	possibly damaging	0.51
R1186:4932438A13Rik	UTSW	3	36,996,312 (GRCm38)	unclassified	probably benign
R1201:4932438A13Rik	UTSW	3	36,948,375 (GRCm38)	missense	probably benign
R1219:4932438A13Rik	UTSW	3	36,946,470 (GRCm38)	nonsense	probably null
R1270:4932438A13Rik	UTSW	3	36,952,184 (GRCm38)	missense	probably damaging	1.00
R1273:4932438A13Rik	UTSW	3	36,987,210 (GRCm38)	missense	probably damaging	1.00
R1338:4932438A13Rik	UTSW	3	37,052,535 (GRCm38)	missense	unknown
R1364:4932438A13Rik	UTSW	3	36,987,030 (GRCm38)	missense	probably damaging	1.00
R1437:4932438A13Rik	UTSW	3	36,942,429 (GRCm38)	missense	possibly damaging	0.65
R1447:4932438A13Rik	UTSW	3	36,965,586 (GRCm38)	missense	probably damaging	0.98
R1467:4932438A13Rik	UTSW	3	37,035,945 (GRCm38)	missense	probably damaging	0.99
R1467:4932438A13Rik	UTSW	3	37,035,945 (GRCm38)	missense	probably damaging	0.99
R1470:4932438A13Rik	UTSW	3	36,998,331 (GRCm38)	missense	probably benign	0.31
R1470:4932438A13Rik	UTSW	3	36,998,331 (GRCm38)	missense	probably benign	0.31
R1481:4932438A13Rik	UTSW	3	37,008,434 (GRCm38)	missense	probably damaging	0.99
R1528:4932438A13Rik	UTSW	3	37,052,535 (GRCm38)	missense	unknown
R1533:4932438A13Rik	UTSW	3	37,041,375 (GRCm38)	missense	probably damaging	1.00
R1546:4932438A13Rik	UTSW	3	36,870,056 (GRCm38)	missense	possibly damaging	0.64
R1606:4932438A13Rik	UTSW	3	36,942,399 (GRCm38)	missense	probably damaging	1.00
R1638:4932438A13Rik	UTSW	3	37,035,812 (GRCm38)	nonsense	probably null
R1772:4932438A13Rik	UTSW	3	36,959,432 (GRCm38)	missense	probably damaging	1.00
R1896:4932438A13Rik	UTSW	3	36,908,231 (GRCm38)	nonsense	probably null
R1919:4932438A13Rik	UTSW	3	37,006,983 (GRCm38)	critical splice acceptor site	probably null
R1983:4932438A13Rik	UTSW	3	36,887,865 (GRCm38)	missense	probably null	1.00
R1987:4932438A13Rik	UTSW	3	36,953,985 (GRCm38)	critical splice donor site	probably null
R1992:4932438A13Rik	UTSW	3	37,000,032 (GRCm38)	missense	probably benign	0.32
R1999:4932438A13Rik	UTSW	3	36,908,211 (GRCm38)	missense	probably damaging	1.00
R2004:4932438A13Rik	UTSW	3	36,895,378 (GRCm38)	missense	possibly damaging	0.77
R2010:4932438A13Rik	UTSW	3	36,928,551 (GRCm38)	missense	probably benign	0.09
R2027:4932438A13Rik	UTSW	3	37,047,961 (GRCm38)	splice site	probably benign
R2039:4932438A13Rik	UTSW	3	37,003,878 (GRCm38)	missense	possibly damaging	0.66
R2054:4932438A13Rik	UTSW	3	36,947,853 (GRCm38)	missense	probably benign	0.01
R2089:4932438A13Rik	UTSW	3	36,988,256 (GRCm38)	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36,988,256 (GRCm38)	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36,988,256 (GRCm38)	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36,953,970 (GRCm38)	missense	probably damaging	1.00
R2220:4932438A13Rik	UTSW	3	36,875,530 (GRCm38)	critical splice donor site	probably null
R2374:4932438A13Rik	UTSW	3	36,885,396 (GRCm38)	missense	probably benign	0.00
R2437:4932438A13Rik	UTSW	3	36,958,685 (GRCm38)	splice site	probably null
R2860:4932438A13Rik	UTSW	3	36,965,849 (GRCm38)	missense	probably damaging	1.00
R2861:4932438A13Rik	UTSW	3	36,965,849 (GRCm38)	missense	probably damaging	1.00
R2909:4932438A13Rik	UTSW	3	36,947,953 (GRCm38)	missense	probably damaging	1.00
R2925:4932438A13Rik	UTSW	3	37,007,122 (GRCm38)	missense	probably damaging	0.99
R2940:4932438A13Rik	UTSW	3	36,958,805 (GRCm38)	missense	probably damaging	1.00
R3015:4932438A13Rik	UTSW	3	36,875,462 (GRCm38)	missense	probably damaging	1.00
R3086:4932438A13Rik	UTSW	3	37,011,703 (GRCm38)	missense	possibly damaging	0.56
R3159:4932438A13Rik	UTSW	3	36,959,415 (GRCm38)	missense	probably benign	0.17
R3440:4932438A13Rik	UTSW	3	37,041,912 (GRCm38)	nonsense	probably null
R3703:4932438A13Rik	UTSW	3	36,987,581 (GRCm38)	missense	probably damaging	1.00
R3705:4932438A13Rik	UTSW	3	36,987,581 (GRCm38)	missense	probably damaging	1.00
R3795:4932438A13Rik	UTSW	3	37,030,565 (GRCm38)	missense	probably benign	0.30
R3820:4932438A13Rik	UTSW	3	37,040,434 (GRCm38)	missense	probably damaging	1.00
R3862:4932438A13Rik	UTSW	3	36,885,398 (GRCm38)	missense	possibly damaging	0.73
R3944:4932438A13Rik	UTSW	3	37,030,061 (GRCm38)	missense	possibly damaging	0.90
R4020:4932438A13Rik	UTSW	3	37,012,575 (GRCm38)	intron	probably benign
R4091:4932438A13Rik	UTSW	3	37,030,589 (GRCm38)	missense	probably benign	0.00
R4159:4932438A13Rik	UTSW	3	36,931,083 (GRCm38)	missense	probably benign	0.00
R4231:4932438A13Rik	UTSW	3	36,920,236 (GRCm38)	missense	probably benign	0.10
R4368:4932438A13Rik	UTSW	3	36,988,147 (GRCm38)	nonsense	probably null
R4413:4932438A13Rik	UTSW	3	36,958,681 (GRCm38)	splice site	probably null
R4475:4932438A13Rik	UTSW	3	37,040,395 (GRCm38)	missense	probably damaging	1.00
R4488:4932438A13Rik	UTSW	3	37,003,933 (GRCm38)	missense	probably null	0.93
R4489:4932438A13Rik	UTSW	3	37,003,933 (GRCm38)	missense	probably null	0.93
R4516:4932438A13Rik	UTSW	3	36,895,311 (GRCm38)	missense	possibly damaging	0.90
R4580:4932438A13Rik	UTSW	3	37,030,025 (GRCm38)	missense	probably benign	0.02
R4672:4932438A13Rik	UTSW	3	36,889,990 (GRCm38)	makesense	probably null
R4705:4932438A13Rik	UTSW	3	37,041,889 (GRCm38)	missense	probably benign	0.03
R4735:4932438A13Rik	UTSW	3	37,004,967 (GRCm38)	missense	possibly damaging	0.84
R4741:4932438A13Rik	UTSW	3	36,942,375 (GRCm38)	missense	probably damaging	0.99
R4754:4932438A13Rik	UTSW	3	37,022,466 (GRCm38)	nonsense	probably null
R4778:4932438A13Rik	UTSW	3	36,937,065 (GRCm38)	missense	possibly damaging	0.90
R4833:4932438A13Rik	UTSW	3	36,964,968 (GRCm38)	missense	probably damaging	0.96
R4896:4932438A13Rik	UTSW	3	36,965,937 (GRCm38)	missense	probably damaging	1.00
R4910:4932438A13Rik	UTSW	3	36,998,199 (GRCm38)	missense	probably damaging	1.00
R4922:4932438A13Rik	UTSW	3	36,987,165 (GRCm38)	missense	probably damaging	1.00
R4941:4932438A13Rik	UTSW	3	36,919,901 (GRCm38)	missense	probably benign	0.41
R4941:4932438A13Rik	UTSW	3	36,917,702 (GRCm38)	missense	probably damaging	1.00
R4980:4932438A13Rik	UTSW	3	36,943,312 (GRCm38)	missense	probably damaging	1.00
R5030:4932438A13Rik	UTSW	3	36,943,399 (GRCm38)	intron	probably benign
R5049:4932438A13Rik	UTSW	3	37,041,390 (GRCm38)	missense	probably damaging	1.00
R5049:4932438A13Rik	UTSW	3	37,040,506 (GRCm38)	intron	probably benign
R5089:4932438A13Rik	UTSW	3	36,987,502 (GRCm38)	missense	probably benign	0.02
R5092:4932438A13Rik	UTSW	3	37,000,085 (GRCm38)	missense	probably benign	0.14
R5122:4932438A13Rik	UTSW	3	37,034,757 (GRCm38)	splice site	probably null
R5210:4932438A13Rik	UTSW	3	37,033,265 (GRCm38)	missense	possibly damaging	0.85
R5246:4932438A13Rik	UTSW	3	37,048,050 (GRCm38)	missense	probably damaging	1.00
R5289:4932438A13Rik	UTSW	3	37,000,109 (GRCm38)	missense	probably damaging	0.97
R5348:4932438A13Rik	UTSW	3	37,048,146 (GRCm38)	missense	probably damaging	1.00
R5394:4932438A13Rik	UTSW	3	36,917,668 (GRCm38)	missense	probably damaging	1.00
R5434:4932438A13Rik	UTSW	3	36,875,516 (GRCm38)	missense	probably damaging	1.00
R5667:4932438A13Rik	UTSW	3	36,917,677 (GRCm38)	missense	probably benign	0.00
R5686:4932438A13Rik	UTSW	3	36,917,660 (GRCm38)	missense	probably benign	0.00
R5701:4932438A13Rik	UTSW	3	36,921,360 (GRCm38)	missense	probably benign	0.10
R5778:4932438A13Rik	UTSW	3	36,958,714 (GRCm38)	missense	probably damaging	1.00
R5787:4932438A13Rik	UTSW	3	36,992,733 (GRCm38)	splice site	probably null
R5800:4932438A13Rik	UTSW	3	37,052,443 (GRCm38)	missense	probably damaging	1.00
R5820:4932438A13Rik	UTSW	3	37,039,526 (GRCm38)	missense	probably benign	0.00
R5952:4932438A13Rik	UTSW	3	36,965,621 (GRCm38)	missense	probably damaging	1.00
R5975:4932438A13Rik	UTSW	3	36,969,221 (GRCm38)	missense	possibly damaging	0.64
R5996:4932438A13Rik	UTSW	3	36,931,116 (GRCm38)	missense	probably benign	0.07
R6192:4932438A13Rik	UTSW	3	36,988,169 (GRCm38)	missense	probably benign	0.00
R6225:4932438A13Rik	UTSW	3	36,948,304 (GRCm38)	missense	probably damaging	1.00
R6234:4932438A13Rik	UTSW	3	36,983,471 (GRCm38)	missense	probably benign	0.00
R6244:4932438A13Rik	UTSW	3	36,956,999 (GRCm38)	missense	probably benign
R6263:4932438A13Rik	UTSW	3	36,931,111 (GRCm38)	missense	probably benign	0.06
R6351:4932438A13Rik	UTSW	3	36,908,228 (GRCm38)	missense	probably damaging	1.00
R6380:4932438A13Rik	UTSW	3	37,033,307 (GRCm38)	missense	probably benign	0.19
R6468:4932438A13Rik	UTSW	3	37,008,443 (GRCm38)	missense	probably damaging	1.00
R6759:4932438A13Rik	UTSW	3	36,988,085 (GRCm38)	missense	possibly damaging	0.81
R6792:4932438A13Rik	UTSW	3	37,011,566 (GRCm38)	critical splice acceptor site	probably null
R6809:4932438A13Rik	UTSW	3	36,874,282 (GRCm38)	missense	probably damaging	0.98
R6841:4932438A13Rik	UTSW	3	37,021,481 (GRCm38)	missense	probably damaging	1.00
R6959:4932438A13Rik	UTSW	3	36,967,189 (GRCm38)	missense	probably damaging	1.00
R7102:4932438A13Rik	UTSW	3	36,940,798 (GRCm38)	missense	probably damaging	0.99
R7188:4932438A13Rik	UTSW	3	36,950,013 (GRCm38)	missense	probably benign	0.06
R7212:4932438A13Rik	UTSW	3	37,048,009 (GRCm38)	missense
R7425:4932438A13Rik	UTSW	3	36,983,394 (GRCm38)	missense	probably benign	0.02
R7425:4932438A13Rik	UTSW	3	36,948,341 (GRCm38)	missense	probably benign
R7451:4932438A13Rik	UTSW	3	37,022,807 (GRCm38)	splice site	probably null
R7604:4932438A13Rik	UTSW	3	36,949,843 (GRCm38)	splice site	probably null
R7622:4932438A13Rik	UTSW	3	36,948,413 (GRCm38)	nonsense	probably null
R7671:4932438A13Rik	UTSW	3	36,943,231 (GRCm38)	missense	probably damaging	0.99
R7699:4932438A13Rik	UTSW	3	37,026,154 (GRCm38)	missense	probably benign	0.00
R7699:4932438A13Rik	UTSW	3	36,974,172 (GRCm38)	missense	possibly damaging	0.67
R7700:4932438A13Rik	UTSW	3	36,974,172 (GRCm38)	missense	possibly damaging	0.67
R7700:4932438A13Rik	UTSW	3	37,026,154 (GRCm38)	missense	probably benign	0.00
R7748:4932438A13Rik	UTSW	3	36,959,335 (GRCm38)	critical splice acceptor site	probably null
R7767:4932438A13Rik	UTSW	3	36,920,287 (GRCm38)	critical splice donor site	probably null
R7787:4932438A13Rik	UTSW	3	36,885,408 (GRCm38)	missense	probably damaging	1.00
R7830:4932438A13Rik	UTSW	3	36,964,932 (GRCm38)	frame shift	probably null
R7849:4932438A13Rik	UTSW	3	37,026,328 (GRCm38)	missense
R7912:4932438A13Rik	UTSW	3	37,007,069 (GRCm38)	missense	probably damaging	0.99
R7914:4932438A13Rik	UTSW	3	36,946,283 (GRCm38)	missense	probably benign	0.13
R7945:4932438A13Rik	UTSW	3	36,965,893 (GRCm38)	missense	probably benign	0.03
R8039:4932438A13Rik	UTSW	3	36,943,214 (GRCm38)	missense	probably benign	0.12
R8101:4932438A13Rik	UTSW	3	37,008,502 (GRCm38)	missense	probably damaging	1.00
R8143:4932438A13Rik	UTSW	3	36,946,508 (GRCm38)	critical splice donor site	probably null
R8145:4932438A13Rik	UTSW	3	36,998,267 (GRCm38)	missense	probably damaging	1.00
R8171:4932438A13Rik	UTSW	3	36,975,713 (GRCm38)	missense	probably benign	0.00
R8210:4932438A13Rik	UTSW	3	37,012,881 (GRCm38)	missense
R8250:4932438A13Rik	UTSW	3	36,917,662 (GRCm38)	missense	probably damaging	0.99
R8369:4932438A13Rik	UTSW	3	37,011,603 (GRCm38)	missense
R8478:4932438A13Rik	UTSW	3	37,033,277 (GRCm38)	missense	possibly damaging	0.74
R8558:4932438A13Rik	UTSW	3	37,048,601 (GRCm38)	missense
R8688:4932438A13Rik	UTSW	3	37,035,917 (GRCm38)	missense
R8724:4932438A13Rik	UTSW	3	36,890,893 (GRCm38)	missense	probably damaging	0.99
R8818:4932438A13Rik	UTSW	3	36,996,548 (GRCm38)	missense	possibly damaging	0.60
R8869:4932438A13Rik	UTSW	3	36,958,858 (GRCm38)	missense	probably damaging	0.99
R8887:4932438A13Rik	UTSW	3	37,033,354 (GRCm38)	missense	possibly damaging	0.95
R8899:4932438A13Rik	UTSW	3	36,988,280 (GRCm38)	missense	probably damaging	1.00
R8907:4932438A13Rik	UTSW	3	36,948,146 (GRCm38)	nonsense	probably null
R8960:4932438A13Rik	UTSW	3	37,012,983 (GRCm38)	missense	probably damaging	1.00
R8990:4932438A13Rik	UTSW	3	36,921,221 (GRCm38)	missense	possibly damaging	0.60
R9021:4932438A13Rik	UTSW	3	36,998,344 (GRCm38)	missense	probably benign	0.00
R9048:4932438A13Rik	UTSW	3	37,011,777 (GRCm38)	missense
R9100:4932438A13Rik	UTSW	3	37,044,758 (GRCm38)	missense
R9166:4932438A13Rik	UTSW	3	36,987,367 (GRCm38)	missense	probably damaging	1.00
R9176:4932438A13Rik	UTSW	3	36,956,703 (GRCm38)	missense	possibly damaging	0.82
R9202:4932438A13Rik	UTSW	3	36,890,821 (GRCm38)	missense	probably benign
R9303:4932438A13Rik	UTSW	3	37,044,820 (GRCm38)	missense
R9305:4932438A13Rik	UTSW	3	37,044,820 (GRCm38)	missense
R9332:4932438A13Rik	UTSW	3	37,050,840 (GRCm38)	missense
R9362:4932438A13Rik	UTSW	3	36,957,013 (GRCm38)	missense	probably benign
R9493:4932438A13Rik	UTSW	3	37,011,736 (GRCm38)	missense
R9534:4932438A13Rik	UTSW	3	36,998,270 (GRCm38)	missense	probably benign	0.01
R9569:4932438A13Rik	UTSW	3	37,012,621 (GRCm38)	missense
R9593:4932438A13Rik	UTSW	3	36,947,941 (GRCm38)	missense	probably damaging	1.00
R9600:4932438A13Rik	UTSW	3	37,041,416 (GRCm38)	nonsense	probably null
R9733:4932438A13Rik	UTSW	3	37,048,583 (GRCm38)	missense
R9751:4932438A13Rik	UTSW	3	37,011,740 (GRCm38)	missense
RF013:4932438A13Rik	UTSW	3	37,050,757 (GRCm38)	critical splice acceptor site	probably benign
RF015:4932438A13Rik	UTSW	3	37,050,748 (GRCm38)	critical splice acceptor site	probably benign
RF021:4932438A13Rik	UTSW	3	37,050,748 (GRCm38)	critical splice acceptor site	probably benign
RF023:4932438A13Rik	UTSW	3	37,050,760 (GRCm38)	critical splice acceptor site	probably benign
RF034:4932438A13Rik	UTSW	3	37,050,760 (GRCm38)	critical splice acceptor site	probably benign
RF035:4932438A13Rik	UTSW	3	37,050,758 (GRCm38)	critical splice acceptor site	probably benign
RF055:4932438A13Rik	UTSW	3	37,050,757 (GRCm38)	critical splice acceptor site	probably benign
X0050:4932438A13Rik	UTSW	3	36,957,128 (GRCm38)	missense	probably damaging	1.00
Z1088:4932438A13Rik	UTSW	3	36,987,567 (GRCm38)	missense	probably damaging	1.00
Z1177:4932438A13Rik	UTSW	3	36,983,440 (GRCm38)	missense	possibly damaging	0.88
Z1177:4932438A13Rik	UTSW	3	36,919,950 (GRCm38)	missense	probably benign
Z1177:4932438A13Rik	UTSW	3	37,036,707 (GRCm38)	missense

Predicted Primers

PCR Primer
(F):5'- GCAGTTGCTCATTTCCCAAATC -3'
(R):5'- TGACATTTGCAGTCCACAGAG -3'

Sequencing Primer
(F):5'- ACAAGTGTATGCATTTACATGGATC -3'
(R):5'- GAGGAAAAAGGCATTCATCCTATC -3'

Posted On

2016-12-20