Incidental Mutation 'R5819:Zfp777'
ID449218
Institutional Source Beutler Lab
Gene Symbol Zfp777
Ensembl Gene ENSMUSG00000071477
Gene Namezinc finger protein 777
Synonyms
MMRRC Submission 043399-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.762) question?
Stock #R5819 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48024188-48048911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48037588 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 395 (E395K)
Ref Sequence ENSEMBL: ENSMUSP00000110230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095944] [ENSMUST00000114583]
Predicted Effect probably damaging
Transcript: ENSMUST00000095944
AA Change: E351K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093637
Gene: ENSMUSG00000071477
AA Change: E351K

DomainStartEndE-ValueType
Pfam:DUF3669 177 256 4.3e-12 PFAM
KRAB 284 344 1.6e-29 SMART
low complexity region 422 433 N/A INTRINSIC
coiled coil region 454 477 N/A INTRINSIC
low complexity region 489 505 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 539 555 N/A INTRINSIC
ZnF_C2H2 557 579 1.2e-5 SMART
ZnF_C2H2 585 607 3.8e-5 SMART
ZnF_C2H2 646 668 1.1e-6 SMART
ZnF_C2H2 674 696 4.6e-6 SMART
ZnF_C2H2 704 726 3.2e-7 SMART
ZnF_C2H2 732 754 3.3e-6 SMART
ZnF_C2H2 760 782 8.4e-6 SMART
ZnF_C2H2 788 810 4.9e-5 SMART
ZnF_C2H2 816 838 1.1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114583
AA Change: E395K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110230
Gene: ENSMUSG00000071477
AA Change: E395K

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:DUF3669 231 298 4.7e-12 PFAM
KRAB 328 388 3.96e-27 SMART
low complexity region 466 477 N/A INTRINSIC
coiled coil region 498 521 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
low complexity region 583 599 N/A INTRINSIC
ZnF_C2H2 601 623 2.95e-3 SMART
ZnF_C2H2 629 651 8.94e-3 SMART
ZnF_C2H2 690 712 2.43e-4 SMART
ZnF_C2H2 718 740 1.12e-3 SMART
ZnF_C2H2 748 770 7.49e-5 SMART
ZnF_C2H2 776 798 7.9e-4 SMART
ZnF_C2H2 804 826 1.95e-3 SMART
ZnF_C2H2 832 854 1.18e-2 SMART
ZnF_C2H2 860 882 2.53e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000148362
AA Change: E203K
SMART Domains Protein: ENSMUSP00000116303
Gene: ENSMUSG00000071477
AA Change: E203K

DomainStartEndE-ValueType
Pfam:DUF3669 40 107 6.1e-13 PFAM
KRAB 137 197 3.96e-27 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Zfp777
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Zfp777 APN 6 48043984 missense probably damaging 1.00
IGL01916:Zfp777 APN 6 48025342 missense probably damaging 1.00
IGL01959:Zfp777 APN 6 48044341 missense probably benign
IGL02167:Zfp777 APN 6 48044526 missense probably damaging 0.98
IGL03150:Zfp777 APN 6 48044125 missense probably damaging 1.00
R0238:Zfp777 UTSW 6 48024969 missense probably damaging 0.99
R0238:Zfp777 UTSW 6 48024969 missense probably damaging 0.99
R0372:Zfp777 UTSW 6 48044476 missense possibly damaging 0.62
R0762:Zfp777 UTSW 6 48029360 missense probably damaging 1.00
R1300:Zfp777 UTSW 6 48025770 missense probably benign 0.43
R1727:Zfp777 UTSW 6 48043890 missense probably damaging 0.99
R1906:Zfp777 UTSW 6 48042061 missense probably damaging 0.99
R2047:Zfp777 UTSW 6 48044346 missense probably benign
R2097:Zfp777 UTSW 6 48044242 missense probably benign 0.08
R2211:Zfp777 UTSW 6 48043885 missense possibly damaging 0.79
R2898:Zfp777 UTSW 6 48025660 missense probably damaging 0.97
R3123:Zfp777 UTSW 6 48029116 unclassified probably benign
R3832:Zfp777 UTSW 6 48044215 missense probably benign 0.00
R4019:Zfp777 UTSW 6 48042112 missense probably damaging 1.00
R4077:Zfp777 UTSW 6 48025522 missense probably benign
R4471:Zfp777 UTSW 6 48042107 missense probably damaging 1.00
R5021:Zfp777 UTSW 6 48042127 missense probably damaging 0.99
R5030:Zfp777 UTSW 6 48037667 missense probably damaging 0.99
R6544:Zfp777 UTSW 6 48044485 missense probably damaging 0.98
R6736:Zfp777 UTSW 6 48024856 missense probably damaging 0.99
R6971:Zfp777 UTSW 6 48024691 missense probably damaging 1.00
R7240:Zfp777 UTSW 6 48044449 missense probably benign 0.00
R7258:Zfp777 UTSW 6 48025797 missense probably damaging 0.99
R7586:Zfp777 UTSW 6 48029218 missense probably benign 0.33
R7833:Zfp777 UTSW 6 48025138 missense probably damaging 0.99
R7947:Zfp777 UTSW 6 48024711 missense probably damaging 1.00
R8136:Zfp777 UTSW 6 48044625 missense probably benign 0.25
R8151:Zfp777 UTSW 6 48029141 nonsense probably null
R8348:Zfp777 UTSW 6 48029167 missense probably damaging 0.99
RF008:Zfp777 UTSW 6 48042048 nonsense probably null
Z1177:Zfp777 UTSW 6 48025234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTAACTTCCTGCAGGCCTC -3'
(R):5'- GAGGTGAATACTTGCCCGTTTC -3'

Sequencing Primer
(F):5'- CCTTCCTGCAGAGCTTGATAC -3'
(R):5'- TTGCCAGCATAGCCAGTC -3'
Posted On2016-12-20