Incidental Mutation 'R5819:Efr3b'
ID449236
Institutional Source Beutler Lab
Gene Symbol Efr3b
Ensembl Gene ENSMUSG00000020658
Gene NameEFR3 homolog B
Synonyms
MMRRC Submission 043399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5819 (G1)
Quality Score169
Status Not validated
Chromosome12
Chromosomal Location3962554-4038915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3992965 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 102 (M102V)
Ref Sequence ENSEMBL: ENSMUSP00000106809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111178] [ENSMUST00000218166]
Predicted Effect probably benign
Transcript: ENSMUST00000111178
AA Change: M102V

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106809
Gene: ENSMUSG00000020658
AA Change: M102V

DomainStartEndE-ValueType
SCOP:d1qbkb_ 55 306 1e-3 SMART
low complexity region 591 602 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218545
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Efr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Efr3b APN 12 3975411 nonsense probably null
IGL01288:Efr3b APN 12 3982865 missense probably damaging 1.00
IGL01467:Efr3b APN 12 3969597 missense probably damaging 0.98
IGL01964:Efr3b APN 12 3982928 missense probably damaging 1.00
IGL02253:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02329:Efr3b APN 12 3992923 unclassified probably null
IGL02365:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02373:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02390:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02392:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02494:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02496:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02501:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02529:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02530:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02532:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02699:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02716:Efr3b APN 12 3984627 missense probably damaging 1.00
IGL02904:Efr3b APN 12 3984583 missense probably damaging 0.99
IGL02986:Efr3b APN 12 3966495 missense probably benign 0.13
IGL03171:Efr3b APN 12 3968622 missense probably benign 0.00
IGL03346:Efr3b APN 12 3984648 missense probably damaging 1.00
PIT4418001:Efr3b UTSW 12 3980490 missense possibly damaging 0.64
R0017:Efr3b UTSW 12 3993003 missense probably damaging 0.98
R0189:Efr3b UTSW 12 3982925 missense probably damaging 1.00
R0361:Efr3b UTSW 12 3977923 missense probably benign 0.00
R0469:Efr3b UTSW 12 3982058 missense probably benign 0.02
R0510:Efr3b UTSW 12 3982058 missense probably benign 0.02
R0782:Efr3b UTSW 12 3984686 splice site probably benign
R2042:Efr3b UTSW 12 3984627 missense probably damaging 1.00
R2359:Efr3b UTSW 12 3980136 unclassified probably benign
R3691:Efr3b UTSW 12 3982059 missense possibly damaging 0.84
R3849:Efr3b UTSW 12 3983414 missense probably benign 0.40
R5384:Efr3b UTSW 12 3983419 missense probably benign 0.04
R5970:Efr3b UTSW 12 3968590 missense possibly damaging 0.93
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6759:Efr3b UTSW 12 3984613 missense probably damaging 1.00
R6969:Efr3b UTSW 12 3968624 missense probably benign 0.08
R7392:Efr3b UTSW 12 3969588 missense probably benign
R7717:Efr3b UTSW 12 3984574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAGGTATATAGCTTAGGGTAGC -3'
(R):5'- CAAATGCGGCTGAGACACTG -3'

Sequencing Primer
(F):5'- AGCTTAGGGTAGCATTCTCAACCTG -3'
(R):5'- TGCCAGCCCACAGATGTATCTC -3'
Posted On2016-12-20