Incidental Mutation 'R5819:Rarb'
ID449240
Institutional Source Beutler Lab
Gene Symbol Rarb
Ensembl Gene ENSMUSG00000017491
Gene Nameretinoic acid receptor, beta
SynonymsRAR beta 2, Hap, RARbeta2
MMRRC Submission 043399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5819 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location16430839-16819156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 16443820 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 156 (N156T)
Ref Sequence ENSEMBL: ENSMUSP00000152980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063750] [ENSMUST00000223576] [ENSMUST00000225594] [ENSMUST00000225921]
Predicted Effect probably benign
Transcript: ENSMUST00000063750
AA Change: N156T

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067694
Gene: ENSMUSG00000017491
AA Change: N156T

DomainStartEndE-ValueType
low complexity region 52 75 N/A INTRINSIC
ZnF_C4 78 149 3.77e-40 SMART
HOLI 223 381 1.72e-34 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223576
Predicted Effect probably benign
Transcript: ENSMUST00000225594
Predicted Effect possibly damaging
Transcript: ENSMUST00000225921
AA Change: N156T

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, but are otherwise normal. Rarb/Rara double knockouts exhibit impaired vitamin A signaling and develop urogenital malformations, including renal hypoplasia and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Rarb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Rarb APN 14 16443791 nonsense probably null
IGL01483:Rarb APN 14 16432273 splice site probably benign
IGL01591:Rarb APN 14 16434207 missense possibly damaging 0.93
IGL01769:Rarb APN 14 16443760 missense probably damaging 0.97
IGL01782:Rarb APN 14 16434180 missense probably damaging 1.00
IGL01866:Rarb APN 14 16443751 missense probably benign 0.17
IGL03299:Rarb APN 14 16434168 missense probably damaging 1.00
IGL03134:Rarb UTSW 14 16436910 missense probably damaging 0.99
R0055:Rarb UTSW 14 16509066 missense probably damaging 1.00
R0055:Rarb UTSW 14 16509066 missense probably damaging 1.00
R0849:Rarb UTSW 14 16434293 missense probably damaging 1.00
R1067:Rarb UTSW 14 16436769 missense probably damaging 0.98
R1314:Rarb UTSW 14 16508932 critical splice donor site probably null
R1416:Rarb UTSW 14 16435177 missense possibly damaging 0.82
R2894:Rarb UTSW 14 16435146 missense probably damaging 1.00
R4637:Rarb UTSW 14 16574875 missense possibly damaging 0.51
R4950:Rarb UTSW 14 16432085 unclassified probably benign
R5420:Rarb UTSW 14 16434249 missense possibly damaging 0.89
R5456:Rarb UTSW 14 16436843 missense probably damaging 1.00
R5635:Rarb UTSW 14 16443788 missense probably damaging 1.00
R5689:Rarb UTSW 14 16434177 missense probably damaging 1.00
R5708:Rarb UTSW 14 16548545 missense probably damaging 0.99
R5935:Rarb UTSW 14 16434264 missense probably damaging 1.00
R6264:Rarb UTSW 14 16818819 missense probably benign 0.31
R6823:Rarb UTSW 14 16443824 missense probably damaging 1.00
R6975:Rarb UTSW 14 16574942 missense possibly damaging 0.92
R7295:Rarb UTSW 14 16508932 critical splice donor site probably null
R7402:Rarb UTSW 14 16548419 missense probably damaging 1.00
R7849:Rarb UTSW 14 16548473 missense probably damaging 1.00
X0065:Rarb UTSW 14 16434303 missense possibly damaging 0.89
Z1177:Rarb UTSW 14 16818725 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGCCAGGCACAAGAAACTGTATG -3'
(R):5'- CTGCACACTAGGAAAGGCAG -3'

Sequencing Primer
(F):5'- TGTGCACAAGGGCCAGTG -3'
(R):5'- AAAGGCAGGCATGGTTCCTTTC -3'
Posted On2016-12-20