Incidental Mutation 'R5819:Tas2r119'
ID449244
Institutional Source Beutler Lab
Gene Symbol Tas2r119
Ensembl Gene ENSMUSG00000045267
Gene Nametaste receptor, type 2, member 119
SynonymsmGR19, T2R19, mt2r19, Tas2r19
MMRRC Submission 043399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5819 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location32177289-32178294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32177306 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 6 (L6P)
Ref Sequence ENSEMBL: ENSMUSP00000050277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057633]
Predicted Effect probably damaging
Transcript: ENSMUST00000057633
AA Change: L6P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050277
Gene: ENSMUSG00000045267
AA Change: L6P

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 1.1e-90 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. This intronless taste receptor gene encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is mapped to chromosome 5p15, the location of a genetic locus (PROP) that controls the detection of the bitter compound 6-n-propyl-2-thiouracil. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Tas2r119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Tas2r119 APN 15 32177453 missense probably damaging 0.97
IGL01522:Tas2r119 APN 15 32178193 missense probably benign 0.15
IGL01548:Tas2r119 APN 15 32177977 missense probably damaging 1.00
IGL01826:Tas2r119 APN 15 32177402 missense probably damaging 1.00
IGL02432:Tas2r119 APN 15 32177707 missense probably benign 0.06
IGL02585:Tas2r119 APN 15 32177533 missense probably benign 0.04
R2248:Tas2r119 UTSW 15 32178151 missense possibly damaging 0.51
R2432:Tas2r119 UTSW 15 32178019 missense possibly damaging 0.80
R5098:Tas2r119 UTSW 15 32178082 missense probably benign 0.03
R5624:Tas2r119 UTSW 15 32177968 missense probably damaging 1.00
R5901:Tas2r119 UTSW 15 32177786 missense possibly damaging 0.84
R6363:Tas2r119 UTSW 15 32177888 missense possibly damaging 0.91
R6495:Tas2r119 UTSW 15 32177530 missense probably benign
R6521:Tas2r119 UTSW 15 32178173 missense probably damaging 1.00
R7574:Tas2r119 UTSW 15 32178133 missense probably damaging 1.00
X0063:Tas2r119 UTSW 15 32178155 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATTGAGTTGAGAAGGCAGCAC -3'
(R):5'- CAAACAGGATAGACCCAGCTGTG -3'

Sequencing Primer
(F):5'- GGCAGCACTATAAACAAATGGGCC -3'
(R):5'- GGATAGACCCAGCTGTGCAAAC -3'
Posted On2016-12-20