Incidental Mutation 'R5819:Ms4a10'
ID449248
Institutional Source Beutler Lab
Gene Symbol Ms4a10
Ensembl Gene ENSMUSG00000024731
Gene Namemembrane-spanning 4-domains, subfamily A, member 10
Synonyms2010001N17Rik
MMRRC Submission 043399-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5819 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10962293-10974670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 10968690 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 26 (A26S)
Ref Sequence ENSEMBL: ENSMUSP00000140111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072748] [ENSMUST00000190246] [ENSMUST00000191343]
Predicted Effect probably benign
Transcript: ENSMUST00000072748
AA Change: A26S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072531
Gene: ENSMUSG00000024731
AA Change: A26S

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 56 190 6e-10 PFAM
low complexity region 239 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190246
SMART Domains Protein: ENSMUSP00000140826
Gene: ENSMUSG00000024731

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191343
AA Change: A26S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140111
Gene: ENSMUSG00000024731
AA Change: A26S

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 57 150 7.9e-14 PFAM
low complexity region 199 212 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Most MS4A genes, including MS4A10, encode proteins with at least 4 potential transmembrane domains and N- and C-terminal cytoplasmic domains encoded by distinct exons.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Ms4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Ms4a10 APN 19 10963010 missense probably benign
IGL03031:Ms4a10 APN 19 10968671 missense probably benign 0.01
P0027:Ms4a10 UTSW 19 10964128 missense probably damaging 0.99
R0863:Ms4a10 UTSW 19 10968593 missense probably damaging 1.00
R1456:Ms4a10 UTSW 19 10964733 missense possibly damaging 0.91
R1509:Ms4a10 UTSW 19 10964108 missense probably benign 0.01
R1838:Ms4a10 UTSW 19 10964047 missense possibly damaging 0.92
R4583:Ms4a10 UTSW 19 10968189 missense possibly damaging 0.94
R4932:Ms4a10 UTSW 19 10964768 missense probably damaging 1.00
R5548:Ms4a10 UTSW 19 10968120 critical splice donor site probably null
R5952:Ms4a10 UTSW 19 10964122 missense probably damaging 1.00
R7026:Ms4a10 UTSW 19 10967505 splice site probably null
R8063:Ms4a10 UTSW 19 10964772 missense probably benign 0.01
R8323:Ms4a10 UTSW 19 10962999 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTTGGACCCTGTTCACAC -3'
(R):5'- TGGACAAGGCCATCACTGTC -3'

Sequencing Primer
(F):5'- AGCCTCCCTGTTGCATAGATTTCAG -3'
(R):5'- CCATCACTGTCCGCGGG -3'
Posted On2016-12-20