Mutagenetix > Incidental Mutation

Incidental Mutation 'R5819:Prkg1'

449249

Institutional Source

Beutler Lab

Gene Symbol

Prkg1

Ensembl Gene

ENSMUSG00000052920

Gene Name

protein kinase, cGMP-dependent, type I

Synonyms

Prkgr1b, Prkg1b

MMRRC Submission

043399-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.516) question?

Stock #

R5819 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30567551-31765033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31585672 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 110 (S110P)

Ref Sequence

ENSEMBL: ENSMUSP00000067576 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]

AlphaFold

P0C605

Predicted Effect

probably benign
Transcript: ENSMUST00000065067
AA Change: S110P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: S110P

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
cNMP	103	216	6.37e-27	SMART
cNMP	221	343	1.23e-33	SMART
S_TKc	360	619	5.25e-91	SMART
S_TK_X	620	671	1.55e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073581
AA Change: S125P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: S125P

Domain	Start	End	E-Value	Type
coiled coil region	10	62	N/A	INTRINSIC
cNMP	118	231	6.37e-27	SMART
cNMP	236	358	1.23e-33	SMART
S_TKc	375	634	5.25e-91	SMART
S_TK_X	635	686	1.55e-10	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	T	3: 37,048,600	M4863L	probably benign	Het
Abca4	A	T	3: 122,136,981	I1376F	probably damaging	Het
Aggf1	T	C	13: 95,351,621	N673D	possibly damaging	Het
Avil	T	C	10: 127,009,998	F372S	probably damaging	Het
Bod1l	T	A	5: 41,832,605	E258D	probably benign	Het
Ccdc129	A	T	6: 55,897,891	K275N	probably benign	Het
Chek1	T	A	9: 36,710,405	H420L	probably benign	Het
Cyfip1	A	G	7: 55,879,151	I260M	probably damaging	Het
Dclk1	G	A	3: 55,489,864	V524I	probably damaging	Het
Efr3b	T	C	12: 3,992,965	M102V	probably benign	Het
Erc2	T	A	14: 28,141,369	I517N	probably damaging	Het
Fubp1	T	C	3: 152,220,553	I305T	probably damaging	Het
Galc	T	A	12: 98,216,261	D443V	probably benign	Het
Galnt4	T	A	10: 99,110,030	I539N	probably damaging	Het
Gm17093	G	T	14: 44,521,529	M169I	unknown	Het
Gm4858	A	G	3: 93,073,732	Y19C	probably damaging	Het
Htra1	T	C	7: 130,981,739	F363S	probably damaging	Het
Klhdc8b	G	A	9: 108,451,062	P64S	probably benign	Het
Kmt2c	A	G	5: 25,409,132		probably null	Het
Mettl21c	T	G	1: 44,009,722	K222Q	probably damaging	Het
Mga	A	C	2: 119,941,263	M1535L	possibly damaging	Het
Mov10	C	T	3: 104,801,512	G395D	probably damaging	Het
Ms4a10	C	A	19: 10,968,690	A26S	probably benign	Het
Naaladl1	A	G	19: 6,109,654	N372D	possibly damaging	Het
Olfr1275	A	T	2: 111,230,959	I278N	probably damaging	Het
Optc	T	C	1: 133,897,879	D303G	probably damaging	Het
Osmr	C	A	15: 6,815,787	V833L	probably benign	Het
Phf14	A	G	6: 11,997,252		probably null	Het
Pjvk	A	G	2: 76,658,369	I295V	probably benign	Het
Plppr4	T	A	3: 117,325,864	I299L	possibly damaging	Het
Ptprq	T	A	10: 107,719,883		probably benign	Het
Rarb	T	G	14: 16,443,820	N156T	possibly damaging	Het
Rgl3	A	T	9: 21,981,602		probably null	Het
Ruvbl1	A	C	6: 88,483,115		probably null	Het
S1pr1	G	T	3: 115,712,140	C268*	probably null	Het
Sbk3	T	C	7: 4,969,997	D58G	probably benign	Het
Scgb2b3	T	A	7: 31,360,214	H45L	possibly damaging	Het
Smim8	TTTAATGAAGAGCT	TT	4: 34,771,261		probably benign	Het
Soga3	A	T	10: 29,197,273	M854L	probably benign	Het
Tas2r119	T	C	15: 32,177,306	L6P	probably damaging	Het
Tcp11	A	T	17: 28,069,236	F339L	probably damaging	Het
Tmprss5	T	A	9: 49,114,479		probably null	Het
Trnau1ap	A	G	4: 132,325,210		probably benign	Het
Trp53bp1	G	A	2: 121,208,392	R1397*	probably null	Het
Ubqln3	G	A	7: 104,141,467	P472L	probably benign	Het
Vmn2r13	T	A	5: 109,174,100	M244L	possibly damaging	Het
Zfp777	C	T	6: 48,037,588	E395K	probably damaging	Het
Zfyve27	A	G	19: 42,183,496	S156G	probably benign	Het

Other mutations in Prkg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Prkg1	APN	19	31302340	missense	probably benign	0.02
IGL00481:Prkg1	APN	19	30571622	missense	probably benign	0.28
IGL00517:Prkg1	APN	19	30894668	missense	probably benign
IGL00782:Prkg1	APN	19	30578753	splice site	probably benign
IGL01070:Prkg1	APN	19	30569343	splice site	probably benign
IGL01106:Prkg1	APN	19	30585278	missense	probably benign	0.05
IGL01783:Prkg1	APN	19	30624689	missense	probably damaging	1.00
IGL02135:Prkg1	APN	19	30993076	missense	probably benign	0.13
IGL02492:Prkg1	APN	19	30724202	missense	probably damaging	1.00
IGL02543:Prkg1	APN	19	30624734	missense	possibly damaging	0.62
IGL02733:Prkg1	APN	19	31302301	missense	probably damaging	1.00
IGL03129:Prkg1	APN	19	30585281	nonsense	probably null
IGL03220:Prkg1	APN	19	30569237	utr 3 prime	probably benign
R0363:Prkg1	UTSW	19	31664196	missense	probably damaging	1.00
R0693:Prkg1	UTSW	19	30594978	missense	probably benign
R1099:Prkg1	UTSW	19	30571612	missense	probably benign
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1556:Prkg1	UTSW	19	30624743	missense	probably benign
R1738:Prkg1	UTSW	19	30786922	missense	possibly damaging	0.48
R1974:Prkg1	UTSW	19	31585695	missense	probably damaging	1.00
R2011:Prkg1	UTSW	19	31664142	missense	possibly damaging	0.94
R2207:Prkg1	UTSW	19	30578860	missense	probably damaging	1.00
R2270:Prkg1	UTSW	19	30578631	missense	probably benign	0.27
R3009:Prkg1	UTSW	19	31664112	missense	possibly damaging	0.74
R4078:Prkg1	UTSW	19	31585578	missense	probably damaging	1.00
R4355:Prkg1	UTSW	19	30569229	utr 3 prime	probably benign
R4652:Prkg1	UTSW	19	30595012	missense	probably damaging	1.00
R4669:Prkg1	UTSW	19	31664239	missense	probably damaging	0.98
R4684:Prkg1	UTSW	19	31664179	nonsense	probably null
R4789:Prkg1	UTSW	19	31585645	missense	probably damaging	0.97
R4826:Prkg1	UTSW	19	31764606	missense	possibly damaging	0.93
R4936:Prkg1	UTSW	19	30586375	missense	probably benign	0.37
R5625:Prkg1	UTSW	19	31764762	missense	possibly damaging	0.95
R5855:Prkg1	UTSW	19	30894694	missense	possibly damaging	0.93
R5882:Prkg1	UTSW	19	31585697	missense	probably damaging	1.00
R5965:Prkg1	UTSW	19	30724156	splice site	probably null
R5968:Prkg1	UTSW	19	30592924	missense	probably damaging	1.00
R6310:Prkg1	UTSW	19	30569251	missense	probably damaging	1.00
R6433:Prkg1	UTSW	19	30781346	missense	probably benign	0.21
R6702:Prkg1	UTSW	19	30993084	missense	probably benign	0.00
R6750:Prkg1	UTSW	19	31764561	missense	probably benign	0.41
R6894:Prkg1	UTSW	19	30624774	nonsense	probably null
R7155:Prkg1	UTSW	19	31302301	missense	probably damaging	1.00
R7165:Prkg1	UTSW	19	30585199	missense	probably damaging	1.00
R7238:Prkg1	UTSW	19	30624690	missense	probably damaging	1.00
R7428:Prkg1	UTSW	19	30578835	missense	probably damaging	1.00
R7748:Prkg1	UTSW	19	30993091	missense	possibly damaging	0.90
R7804:Prkg1	UTSW	19	30578632	missense	probably benign	0.00
R7804:Prkg1	UTSW	19	30624770	missense	possibly damaging	0.92
R7893:Prkg1	UTSW	19	30586367	missense	probably damaging	0.99
R8304:Prkg1	UTSW	19	30724184	missense	possibly damaging	0.75
R8497:Prkg1	UTSW	19	31302309	missense	probably damaging	1.00
R8676:Prkg1	UTSW	19	31764746	missense	probably damaging	0.98
R9318:Prkg1	UTSW	19	30571638	missense	probably benign	0.09
R9694:Prkg1	UTSW	19	30786971	missense	possibly damaging	0.84
X0011:Prkg1	UTSW	19	30993121	missense	probably damaging	1.00
Z1177:Prkg1	UTSW	19	31302373	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTCCCAATGAACGAAGGAAGAC -3'
(R):5'- TCAGGCCTTTCAAGAAGACCC -3'

Sequencing Primer
(F):5'- CACAGAGTACATTGCGATCCTTGAG -3'
(R):5'- AGACCCATTAGTTGTGTGCAAGC -3'

Posted On

2016-12-20