Incidental Mutation 'R5819:Zfyve27'
ID449250
Institutional Source Beutler Lab
Gene Symbol Zfyve27
Ensembl Gene ENSMUSG00000018820
Gene Namezinc finger, FYVE domain containing 27
Synonymsprotrudin, 2210011N02Rik, 9530077C24Rik
MMRRC Submission 043399-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5819 (G1)
Quality Score82
Status Not validated
Chromosome19
Chromosomal Location42163951-42194590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42183496 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 156 (S156G)
Ref Sequence ENSEMBL: ENSMUSP00000129561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099443] [ENSMUST00000168130] [ENSMUST00000169536]
Predicted Effect probably benign
Transcript: ENSMUST00000099443
AA Change: S250G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097042
Gene: ENSMUSG00000018820
AA Change: S250G

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
FYVE 335 408 2.52e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165783
Predicted Effect probably benign
Transcript: ENSMUST00000168130
AA Change: S156G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129561
Gene: ENSMUSG00000018820
AA Change: S156G

DomainStartEndE-ValueType
transmembrane domain 96 118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169536
AA Change: S250G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130684
Gene: ENSMUSG00000018820
AA Change: S250G

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
FYVE 342 415 2.52e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170184
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with several transmembrane domains, a Rab11-binding domain and a lipid-binding FYVE finger domain. The encoded protein appears to promote neurite formation. A mutation in this gene has been reported to be associated with hereditary spastic paraplegia, however the pathogenicity of the mutation, which may simply represent a polymorphism, is unclear. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Other mutations in Zfyve27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Zfyve27 APN 19 42183433 missense probably benign
IGL02040:Zfyve27 APN 19 42179391 missense probably damaging 1.00
IGL02048:Zfyve27 APN 19 42185857 missense probably damaging 0.99
IGL02135:Zfyve27 APN 19 42184136 missense probably damaging 1.00
Forgotten UTSW 19 42189577 missense probably damaging 1.00
ignored UTSW 19 42171731 missense probably benign 0.01
overlooked UTSW 19 42182657 critical splice acceptor site probably null
R0388:Zfyve27 UTSW 19 42189585 missense probably damaging 1.00
R1589:Zfyve27 UTSW 19 42171745 critical splice donor site probably null
R1908:Zfyve27 UTSW 19 42171548 start codon destroyed probably null 1.00
R2151:Zfyve27 UTSW 19 42171731 missense probably benign 0.01
R2204:Zfyve27 UTSW 19 42183446 missense probably damaging 1.00
R2205:Zfyve27 UTSW 19 42183446 missense probably damaging 1.00
R5800:Zfyve27 UTSW 19 42182663 missense probably damaging 1.00
R5870:Zfyve27 UTSW 19 42171671 missense probably benign 0.01
R5959:Zfyve27 UTSW 19 42179448 missense unknown
R6217:Zfyve27 UTSW 19 42189577 missense probably damaging 1.00
R6281:Zfyve27 UTSW 19 42182755 missense probably damaging 1.00
R6337:Zfyve27 UTSW 19 42182657 critical splice acceptor site probably null
R6638:Zfyve27 UTSW 19 42181497 splice site probably null
R7438:Zfyve27 UTSW 19 42189520 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCCAGAGTACCACTTATTGTGTC -3'
(R):5'- TATGACGACGCATCCCAGAG -3'

Sequencing Primer
(F):5'- AGAGTACCACTTATTGTGTCTCTGTC -3'
(R):5'- AGAAGGCCCTCAGCTCTG -3'
Posted On2016-12-20