Incidental Mutation 'R5830:Epha8'
ID449258
Institutional Source Beutler Lab
Gene Symbol Epha8
Ensembl Gene ENSMUSG00000028661
Gene NameEph receptor A8
SynonymsEphA8, Hek3, Eek
MMRRC Submission 043219-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5830 (G1)
Quality Score93
Status Not validated
Chromosome4
Chromosomal Location136929419-136956816 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 136936390 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 452 (Q452*)
Ref Sequence ENSEMBL: ENSMUSP00000030420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030420]
Predicted Effect probably null
Transcript: ENSMUST00000030420
AA Change: Q452*
SMART Domains Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: Q452*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 30 203 2.59e-116 SMART
FN3 328 418 4.03e-6 SMART
FN3 439 520 1.67e-12 SMART
Pfam:EphA2_TM 542 631 5.8e-10 PFAM
TyrKc 634 891 1.03e-125 SMART
SAM 926 993 4.74e-19 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec3 A T 15: 79,899,067 N115I possibly damaging Het
Arl14ep T C 2: 106,969,194 S101G possibly damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccdc40 C A 11: 119,242,746 H571N probably benign Het
Cdc42bpb G A 12: 111,345,582 R99* probably null Het
Cdyl2 A G 8: 116,595,084 Y235H probably benign Het
Chmp2a T C 7: 13,032,112 D161G probably damaging Het
Ep400 A T 5: 110,683,996 W2091R unknown Het
Fbn2 A G 18: 58,114,469 F451S probably benign Het
Fndc1 C A 17: 7,789,086 R72L possibly damaging Het
Gfpt2 A G 11: 49,809,061 E81G probably benign Het
Gpr155 A G 2: 73,370,089 V358A possibly damaging Het
Hnrnpk A T 13: 58,397,734 Y92* probably null Het
Il34 A G 8: 110,748,691 V71A probably damaging Het
Inpp5e A G 2: 26,400,415 F416L probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kdsr A G 1: 106,747,532 S125P possibly damaging Het
Ldb1 T A 19: 46,034,118 M307L probably benign Het
Lrr1 T A 12: 69,178,671 S374T possibly damaging Het
Mtmr2 A G 9: 13,801,978 I412V probably benign Het
Ncor1 T C 11: 62,344,763 I298V possibly damaging Het
Ndst1 A G 18: 60,703,838 F384L probably damaging Het
Nlrc5 A G 8: 94,472,914 E51G probably damaging Het
Obox6 G A 7: 15,834,457 H165Y possibly damaging Het
Olfr181 T A 16: 58,926,094 H159L possibly damaging Het
Pde8b A T 13: 95,041,890 F582Y probably benign Het
Pik3r4 C A 9: 105,644,824 Y196* probably null Het
Pink1 A T 4: 138,316,014 M1K probably null Het
Scn7a A T 2: 66,714,051 Y365* probably null Het
Sec16a A T 2: 26,440,841 D387E probably benign Het
Sel1l A T 12: 91,833,171 F127Y probably damaging Het
Syt7 T A 19: 10,421,787 N82K probably damaging Het
Zfp358 G T 8: 3,495,846 V143L probably benign Het
Zkscan2 T C 7: 123,480,100 N878S possibly damaging Het
Other mutations in Epha8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Epha8 APN 4 136945810 missense probably damaging 1.00
IGL00960:Epha8 APN 4 136951839 splice site probably null
IGL01124:Epha8 APN 4 136936083 missense probably damaging 1.00
IGL01550:Epha8 APN 4 136931740 missense possibly damaging 0.87
IGL01807:Epha8 APN 4 136931682 missense probably benign 0.08
IGL01844:Epha8 APN 4 136931049 makesense probably null
IGL02167:Epha8 APN 4 136931094 missense probably damaging 1.00
R0255:Epha8 UTSW 4 136940286 missense probably damaging 0.99
R0445:Epha8 UTSW 4 136932400 missense probably damaging 1.00
R1757:Epha8 UTSW 4 136931478 splice site probably null
R1911:Epha8 UTSW 4 136936314 missense probably damaging 1.00
R1936:Epha8 UTSW 4 136940243 missense probably benign 0.08
R2291:Epha8 UTSW 4 136933347 missense probably damaging 1.00
R2359:Epha8 UTSW 4 136946032 missense probably damaging 1.00
R2372:Epha8 UTSW 4 136933010 missense probably damaging 1.00
R4581:Epha8 UTSW 4 136933464 missense probably damaging 1.00
R4747:Epha8 UTSW 4 136938695 frame shift probably null
R4784:Epha8 UTSW 4 136933322 missense probably damaging 1.00
R5156:Epha8 UTSW 4 136938726 missense probably benign 0.14
R5164:Epha8 UTSW 4 136945672 missense possibly damaging 0.93
R5335:Epha8 UTSW 4 136931935 missense probably damaging 1.00
R5480:Epha8 UTSW 4 136935130 missense probably benign
R5552:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R6017:Epha8 UTSW 4 136931743 missense probably damaging 1.00
R6450:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R6798:Epha8 UTSW 4 136945669 missense probably benign 0.00
R6799:Epha8 UTSW 4 136945669 missense probably benign 0.00
R7060:Epha8 UTSW 4 136931158 missense probably damaging 1.00
R7297:Epha8 UTSW 4 136945913 missense probably damaging 1.00
R7344:Epha8 UTSW 4 136934538 missense probably benign 0.14
R7467:Epha8 UTSW 4 136931088 missense possibly damaging 0.90
R7563:Epha8 UTSW 4 136938789 missense possibly damaging 0.77
R7826:Epha8 UTSW 4 136936187 missense probably benign 0.09
R7845:Epha8 UTSW 4 136936401 missense probably benign 0.04
R7863:Epha8 UTSW 4 136933655 missense probably damaging 1.00
R7904:Epha8 UTSW 4 136931739 missense possibly damaging 0.95
R7918:Epha8 UTSW 4 136934566 missense probably benign 0.12
R8177:Epha8 UTSW 4 136945663 missense probably benign 0.00
R8244:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8266:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8268:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8269:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8289:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8290:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8294:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8295:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8299:Epha8 UTSW 4 136938586 missense probably damaging 0.98
RF025:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
RF054:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
Z1176:Epha8 UTSW 4 136938696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGGGTAGAGTAACTTTGCATCTC -3'
(R):5'- CAGTGCCTCTCCAGGATATG -3'

Sequencing Primer
(F):5'- TCCTTATCCTGCCCGAAGAAGG -3'
(R):5'- ATATGGGGCTGCAGACTGTC -3'
Posted On2016-12-20