Incidental Mutation 'R5830:Mtmr2'
ID449273
Institutional Source Beutler Lab
Gene Symbol Mtmr2
Ensembl Gene ENSMUSG00000031918
Gene Namemyotubularin related protein 2
Synonyms6030445P13Rik
MMRRC Submission 043219-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R5830 (G1)
Quality Score164
Status Not validated
Chromosome9
Chromosomal Location13748410-13806481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13801978 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 412 (I412V)
Ref Sequence ENSEMBL: ENSMUSP00000115906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034396] [ENSMUST00000134674] [ENSMUST00000155679]
Predicted Effect probably benign
Transcript: ENSMUST00000034396
AA Change: I484V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034396
Gene: ENSMUSG00000031918
AA Change: I484V

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
GRAM 65 139 1.57e-11 SMART
Pfam:Myotub-related 192 529 1.7e-152 PFAM
low complexity region 616 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134674
SMART Domains Protein: ENSMUSP00000121933
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
PDB:1M7R|B 1 62 2e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146901
Predicted Effect probably benign
Transcript: ENSMUST00000155679
AA Change: I412V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115906
Gene: ENSMUSG00000031918
AA Change: I412V

DomainStartEndE-ValueType
GRAM 3 67 6.19e-10 SMART
Pfam:Myotub-related 119 459 6.7e-152 PFAM
Pfam:Y_phosphatase 266 370 3.9e-6 PFAM
low complexity region 544 559 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myotubularin family of phosphoinositide lipid phosphatases. The encoded protein possesses phosphatase activity towards phosphatidylinositol-3-phosphate and phosphatidylinositol-3,5-bisphosphate. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4B, an autosomal recessive demyelinating neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mutants develop progressive neuropathy characterized by myelin outfolding and recurrent loops and depletion of spermatids and spermatocytes from the seminiferous epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec3 A T 15: 79,899,067 N115I possibly damaging Het
Arl14ep T C 2: 106,969,194 S101G possibly damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccdc40 C A 11: 119,242,746 H571N probably benign Het
Cdc42bpb G A 12: 111,345,582 R99* probably null Het
Cdyl2 A G 8: 116,595,084 Y235H probably benign Het
Chmp2a T C 7: 13,032,112 D161G probably damaging Het
Ep400 A T 5: 110,683,996 W2091R unknown Het
Epha8 G A 4: 136,936,390 Q452* probably null Het
Fbn2 A G 18: 58,114,469 F451S probably benign Het
Fndc1 C A 17: 7,789,086 R72L possibly damaging Het
Gfpt2 A G 11: 49,809,061 E81G probably benign Het
Gpr155 A G 2: 73,370,089 V358A possibly damaging Het
Hnrnpk A T 13: 58,397,734 Y92* probably null Het
Il34 A G 8: 110,748,691 V71A probably damaging Het
Inpp5e A G 2: 26,400,415 F416L probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kdsr A G 1: 106,747,532 S125P possibly damaging Het
Ldb1 T A 19: 46,034,118 M307L probably benign Het
Lrr1 T A 12: 69,178,671 S374T possibly damaging Het
Ncor1 T C 11: 62,344,763 I298V possibly damaging Het
Ndst1 A G 18: 60,703,838 F384L probably damaging Het
Nlrc5 A G 8: 94,472,914 E51G probably damaging Het
Obox6 G A 7: 15,834,457 H165Y possibly damaging Het
Olfr181 T A 16: 58,926,094 H159L possibly damaging Het
Pde8b A T 13: 95,041,890 F582Y probably benign Het
Pik3r4 C A 9: 105,644,824 Y196* probably null Het
Pink1 A T 4: 138,316,014 M1K probably null Het
Scn7a A T 2: 66,714,051 Y365* probably null Het
Sec16a A T 2: 26,440,841 D387E probably benign Het
Sel1l A T 12: 91,833,171 F127Y probably damaging Het
Syt7 T A 19: 10,421,787 N82K probably damaging Het
Zfp358 G T 8: 3,495,846 V143L probably benign Het
Zkscan2 T C 7: 123,480,100 N878S possibly damaging Het
Other mutations in Mtmr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Mtmr2 APN 9 13785916 missense probably benign 0.45
IGL01328:Mtmr2 APN 9 13801927 nonsense probably null
IGL02305:Mtmr2 APN 9 13795255 missense probably damaging 1.00
IGL03069:Mtmr2 APN 9 13793205 nonsense probably null
PIT4431001:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R0280:Mtmr2 UTSW 9 13799249 missense probably damaging 1.00
R0636:Mtmr2 UTSW 9 13801913 critical splice acceptor site probably null
R0831:Mtmr2 UTSW 9 13796113 missense probably damaging 0.99
R1202:Mtmr2 UTSW 9 13803452 missense probably benign
R1663:Mtmr2 UTSW 9 13803501 missense probably damaging 1.00
R1679:Mtmr2 UTSW 9 13789077 missense probably damaging 1.00
R2086:Mtmr2 UTSW 9 13799952 missense probably damaging 1.00
R2254:Mtmr2 UTSW 9 13796057 missense possibly damaging 0.49
R2255:Mtmr2 UTSW 9 13796057 missense possibly damaging 0.49
R2932:Mtmr2 UTSW 9 13749117 unclassified probably benign
R4172:Mtmr2 UTSW 9 13800062 missense probably damaging 1.00
R4669:Mtmr2 UTSW 9 13795964 missense probably damaging 1.00
R5248:Mtmr2 UTSW 9 13783609 intron probably benign
R5317:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R5326:Mtmr2 UTSW 9 13788647 missense probably damaging 1.00
R5573:Mtmr2 UTSW 9 13793167 missense probably benign 0.15
R6332:Mtmr2 UTSW 9 13800029 missense probably damaging 0.99
R6638:Mtmr2 UTSW 9 13796133 missense probably damaging 1.00
R6791:Mtmr2 UTSW 9 13805382 missense probably benign 0.02
R7072:Mtmr2 UTSW 9 13788620 missense probably benign 0.00
R7474:Mtmr2 UTSW 9 13799225 missense probably damaging 1.00
R7722:Mtmr2 UTSW 9 13804808 missense probably benign
Z1176:Mtmr2 UTSW 9 13799281 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCAGAAATCTGGACTCTTAAGG -3'
(R):5'- GGGCCAAGATGCTACTAGAATCC -3'

Sequencing Primer
(F):5'- AATCCTCTTGAAGTTTTCATGTGTG -3'
(R):5'- GCCAAGATGCTACTAGAATCCAAGTG -3'
Posted On2016-12-20