Incidental Mutation 'R5830:Iqgap2'
ID449284
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
MMRRC Submission 043219-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5830 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95675372 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 707 (R707H)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably damaging
Transcript: ENSMUST00000068603
AA Change: R707H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: R707H

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec3 A T 15: 79,899,067 N115I possibly damaging Het
Arl14ep T C 2: 106,969,194 S101G possibly damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccdc40 C A 11: 119,242,746 H571N probably benign Het
Cdc42bpb G A 12: 111,345,582 R99* probably null Het
Cdyl2 A G 8: 116,595,084 Y235H probably benign Het
Chmp2a T C 7: 13,032,112 D161G probably damaging Het
Ep400 A T 5: 110,683,996 W2091R unknown Het
Epha8 G A 4: 136,936,390 Q452* probably null Het
Fbn2 A G 18: 58,114,469 F451S probably benign Het
Fndc1 C A 17: 7,789,086 R72L possibly damaging Het
Gfpt2 A G 11: 49,809,061 E81G probably benign Het
Gpr155 A G 2: 73,370,089 V358A possibly damaging Het
Hnrnpk A T 13: 58,397,734 Y92* probably null Het
Il34 A G 8: 110,748,691 V71A probably damaging Het
Inpp5e A G 2: 26,400,415 F416L probably damaging Het
Kdsr A G 1: 106,747,532 S125P possibly damaging Het
Ldb1 T A 19: 46,034,118 M307L probably benign Het
Lrr1 T A 12: 69,178,671 S374T possibly damaging Het
Mtmr2 A G 9: 13,801,978 I412V probably benign Het
Ncor1 T C 11: 62,344,763 I298V possibly damaging Het
Ndst1 A G 18: 60,703,838 F384L probably damaging Het
Nlrc5 A G 8: 94,472,914 E51G probably damaging Het
Obox6 G A 7: 15,834,457 H165Y possibly damaging Het
Olfr181 T A 16: 58,926,094 H159L possibly damaging Het
Pde8b A T 13: 95,041,890 F582Y probably benign Het
Pik3r4 C A 9: 105,644,824 Y196* probably null Het
Pink1 A T 4: 138,316,014 M1K probably null Het
Scn7a A T 2: 66,714,051 Y365* probably null Het
Sec16a A T 2: 26,440,841 D387E probably benign Het
Sel1l A T 12: 91,833,171 F127Y probably damaging Het
Syt7 T A 19: 10,421,787 N82K probably damaging Het
Zfp358 G T 8: 3,495,846 V143L probably benign Het
Zkscan2 T C 7: 123,480,100 N878S possibly damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCCAGGACTAACTTGTAAGGCTC -3'
(R):5'- GAAAACTGGGTGCTAACCTGG -3'

Sequencing Primer
(F):5'- GTAAGGCTCACACATCTCTGG -3'
(R):5'- AACCTGGCCATTGGGTTC -3'
Posted On2016-12-20