Incidental Mutation 'R5830:Ndst1'
ID449290
Institutional Source Beutler Lab
Gene Symbol Ndst1
Ensembl Gene ENSMUSG00000054008
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonymsglucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik
MMRRC Submission 043219-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5830 (G1)
Quality Score218
Status Not validated
Chromosome18
Chromosomal Location60685978-60713389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60703838 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 384 (F384L)
Ref Sequence ENSEMBL: ENSMUSP00000126623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169273]
Predicted Effect probably damaging
Transcript: ENSMUST00000169273
AA Change: F384L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: F384L

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:HSNSD 25 515 5.1e-254 PFAM
Pfam:Sulfotransfer_1 604 869 2.2e-48 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec3 A T 15: 79,899,067 N115I possibly damaging Het
Arl14ep T C 2: 106,969,194 S101G possibly damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccdc40 C A 11: 119,242,746 H571N probably benign Het
Cdc42bpb G A 12: 111,345,582 R99* probably null Het
Cdyl2 A G 8: 116,595,084 Y235H probably benign Het
Chmp2a T C 7: 13,032,112 D161G probably damaging Het
Ep400 A T 5: 110,683,996 W2091R unknown Het
Epha8 G A 4: 136,936,390 Q452* probably null Het
Fbn2 A G 18: 58,114,469 F451S probably benign Het
Fndc1 C A 17: 7,789,086 R72L possibly damaging Het
Gfpt2 A G 11: 49,809,061 E81G probably benign Het
Gpr155 A G 2: 73,370,089 V358A possibly damaging Het
Hnrnpk A T 13: 58,397,734 Y92* probably null Het
Il34 A G 8: 110,748,691 V71A probably damaging Het
Inpp5e A G 2: 26,400,415 F416L probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kdsr A G 1: 106,747,532 S125P possibly damaging Het
Ldb1 T A 19: 46,034,118 M307L probably benign Het
Lrr1 T A 12: 69,178,671 S374T possibly damaging Het
Mtmr2 A G 9: 13,801,978 I412V probably benign Het
Ncor1 T C 11: 62,344,763 I298V possibly damaging Het
Nlrc5 A G 8: 94,472,914 E51G probably damaging Het
Obox6 G A 7: 15,834,457 H165Y possibly damaging Het
Olfr181 T A 16: 58,926,094 H159L possibly damaging Het
Pde8b A T 13: 95,041,890 F582Y probably benign Het
Pik3r4 C A 9: 105,644,824 Y196* probably null Het
Pink1 A T 4: 138,316,014 M1K probably null Het
Scn7a A T 2: 66,714,051 Y365* probably null Het
Sec16a A T 2: 26,440,841 D387E probably benign Het
Sel1l A T 12: 91,833,171 F127Y probably damaging Het
Syt7 T A 19: 10,421,787 N82K probably damaging Het
Zfp358 G T 8: 3,495,846 V143L probably benign Het
Zkscan2 T C 7: 123,480,100 N878S possibly damaging Het
Other mutations in Ndst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ndst1 APN 18 60707956 missense probably damaging 1.00
IGL01410:Ndst1 APN 18 60700445 missense probably damaging 1.00
IGL01578:Ndst1 APN 18 60713126 missense probably damaging 1.00
IGL02133:Ndst1 APN 18 60699546 missense probably benign 0.05
IGL03200:Ndst1 APN 18 60699539 missense possibly damaging 0.86
R0631:Ndst1 UTSW 18 60700359 splice site probably benign
R0899:Ndst1 UTSW 18 60707882 missense probably benign 0.00
R1104:Ndst1 UTSW 18 60697146 missense probably damaging 0.98
R1371:Ndst1 UTSW 18 60707647 missense possibly damaging 0.90
R1456:Ndst1 UTSW 18 60713205 missense possibly damaging 0.73
R1511:Ndst1 UTSW 18 60697170 missense possibly damaging 0.61
R1524:Ndst1 UTSW 18 60698504 missense probably damaging 0.99
R1699:Ndst1 UTSW 18 60695508 missense probably damaging 1.00
R1718:Ndst1 UTSW 18 60707803 missense probably damaging 0.99
R1772:Ndst1 UTSW 18 60702837 missense probably damaging 0.99
R1900:Ndst1 UTSW 18 60712721 critical splice donor site probably null
R2079:Ndst1 UTSW 18 60695509 missense probably damaging 1.00
R2105:Ndst1 UTSW 18 60691253 missense probably benign 0.01
R2127:Ndst1 UTSW 18 60691208 missense probably benign 0.00
R2875:Ndst1 UTSW 18 60690047 missense probably damaging 1.00
R3798:Ndst1 UTSW 18 60713166 missense possibly damaging 0.94
R3950:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3951:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3952:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R4868:Ndst1 UTSW 18 60695476 missense probably benign 0.07
R4898:Ndst1 UTSW 18 60691987 missense probably benign 0.12
R4988:Ndst1 UTSW 18 60702933 missense probably damaging 0.99
R5271:Ndst1 UTSW 18 60705132 missense probably benign 0.03
R5337:Ndst1 UTSW 18 60690007 missense probably damaging 1.00
R5467:Ndst1 UTSW 18 60692021 missense probably benign
R5968:Ndst1 UTSW 18 60713076 missense probably benign
R6241:Ndst1 UTSW 18 60703829 missense probably damaging 0.99
R6422:Ndst1 UTSW 18 60702953 missense probably benign 0.44
R7099:Ndst1 UTSW 18 60695500 missense possibly damaging 0.88
R7544:Ndst1 UTSW 18 60697184 missense probably damaging 1.00
V8831:Ndst1 UTSW 18 60702927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGGCCAACAAATCCCTG -3'
(R):5'- TTACTGAGGGAAGGGCAGTC -3'

Sequencing Primer
(F):5'- GCCAACAAATCCCTGCCCAG -3'
(R):5'- CTGGGCCAAAGCTTAGTTGACTC -3'
Posted On2016-12-20