Incidental Mutation 'R5831:Olfr1186'
ID449297
Institutional Source Beutler Lab
Gene Symbol Olfr1186
Ensembl Gene ENSMUSG00000082882
Gene Nameolfactory receptor 1186
SynonymsGA_x6K02T2Q125-50012960-50013871, MOR230-5
MMRRC Submission 043220-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5831 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88518551-88526790 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 88526480 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 299 (W299*)
Ref Sequence ENSEMBL: ENSMUSP00000151114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075025] [ENSMUST00000121619] [ENSMUST00000215912] [ENSMUST00000216978]
Predicted Effect probably null
Transcript: ENSMUST00000075025
AA Change: W299*
SMART Domains Protein: ENSMUSP00000074542
Gene: ENSMUSG00000057735
AA Change: W299*

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 2.5e-51 PFAM
Pfam:7tm_1 38 284 4.8e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121619
AA Change: W299*
Predicted Effect probably null
Transcript: ENSMUST00000215912
AA Change: W299*
Predicted Effect probably null
Transcript: ENSMUST00000216978
AA Change: W299*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,567,777 K4460* probably null Het
Adam21 A G 12: 81,559,101 V629A probably benign Het
Adamts5 C T 16: 85,868,118 V653I probably damaging Het
Adarb2 G A 13: 8,559,133 A44T probably benign Het
Ank2 T C 3: 127,339,159 probably benign Het
Arhgap21 T C 2: 20,863,213 Y833C probably damaging Het
Brwd1 A G 16: 96,019,436 S1297P probably damaging Het
Cdc25b G T 2: 131,187,381 probably null Het
Ciart A T 3: 95,878,902 V287D probably damaging Het
Csf2ra A G 19: 61,225,212 F353S probably damaging Het
D630045J12Rik C T 6: 38,142,657 E1717K possibly damaging Het
Dhcr24 A G 4: 106,564,414 K82R probably benign Het
Dnah9 T A 11: 66,108,121 T1034S probably benign Het
Dock6 T C 9: 21,803,036 E1837G probably damaging Het
Fam102b A T 3: 108,992,703 S110T possibly damaging Het
Flg2 G A 3: 93,200,234 V9I probably damaging Het
Hif1a A T 12: 73,942,144 T602S probably benign Het
Hip1 T C 5: 135,411,263 E1015G probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irgq C A 7: 24,533,338 F201L probably damaging Het
Isoc2b C A 7: 4,851,024 L116F probably null Het
Loxl3 A T 6: 83,049,018 T416S probably benign Het
Map3k13 A G 16: 21,928,048 *960W probably null Het
Morn1 A G 4: 155,101,276 H183R probably benign Het
Mrc1 A T 2: 14,308,712 N918I probably damaging Het
Nfxl1 A G 5: 72,522,197 V763A probably benign Het
Olfr738 A G 14: 50,413,982 probably null Het
Papola A G 12: 105,823,600 K482E probably benign Het
Pck1 C T 2: 173,156,999 T350I probably damaging Het
Peli2 G A 14: 48,168,270 A51T probably damaging Het
Preb T C 5: 30,958,864 H133R probably benign Het
Rpl36-ps4 T C 17: 87,921,257 V73A probably benign Het
Scaf11 G A 15: 96,417,081 P1240L probably benign Het
Selenom G T 11: 3,516,882 E81* probably null Het
Serpinb1c T C 13: 32,897,098 M1V probably null Het
Tanc1 T C 2: 59,785,341 S231P possibly damaging Het
Trappc10 C T 10: 78,209,426 R476Q probably damaging Het
Twf2 T A 9: 106,214,187 D200E probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn2r71 G A 7: 85,623,714 D579N probably benign Het
Vrtn A T 12: 84,648,575 E33V probably damaging Het
Other mutations in Olfr1186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr1186 APN 2 88525760 missense possibly damaging 0.87
IGL01727:Olfr1186 APN 2 88525927 missense probably benign 0.03
IGL01790:Olfr1186 APN 2 88526423 missense probably damaging 0.99
IGL01868:Olfr1186 APN 2 88525715 missense possibly damaging 0.66
IGL03146:Olfr1186 APN 2 88526144 missense possibly damaging 0.90
IGL03378:Olfr1186 APN 2 88526154 nonsense probably null
R0053:Olfr1186 UTSW 2 88526163 missense probably damaging 1.00
R0829:Olfr1186 UTSW 2 88526228 missense probably damaging 1.00
R1210:Olfr1186 UTSW 2 88526276 missense possibly damaging 0.89
R1754:Olfr1186 UTSW 2 88525815 missense probably damaging 0.99
R2260:Olfr1186 UTSW 2 88526386 missense possibly damaging 0.93
R3426:Olfr1186 UTSW 2 88525864 missense probably damaging 1.00
R3781:Olfr1186 UTSW 2 88526365 missense probably benign 0.23
R4737:Olfr1186 UTSW 2 88526225 missense probably damaging 1.00
R4908:Olfr1186 UTSW 2 88525910 missense probably damaging 1.00
R4932:Olfr1186 UTSW 2 88525735 missense probably benign 0.02
R5071:Olfr1186 UTSW 2 88526041 missense probably damaging 1.00
R6222:Olfr1186 UTSW 2 88499270 missense probably benign 0.34
R6370:Olfr1186 UTSW 2 88499368 nonsense probably null
R6802:Olfr1186 UTSW 2 88525597 missense probably benign 0.02
R6931:Olfr1186 UTSW 2 88526194 missense possibly damaging 0.50
R7044:Olfr1186 UTSW 2 88526486 missense probably benign
R7121:Olfr1186 UTSW 2 88525826 missense probably damaging 1.00
R7166:Olfr1186 UTSW 2 88525646 missense possibly damaging 0.89
R7387:Olfr1186 UTSW 2 88526400 nonsense probably null
R7891:Olfr1186 UTSW 2 88525945 missense probably benign 0.04
R7951:Olfr1186 UTSW 2 88525804 missense probably damaging 0.98
R7978:Olfr1186 UTSW 2 88525670 nonsense probably null
R8016:Olfr1186 UTSW 2 88526173 missense probably damaging 0.99
R8039:Olfr1186 UTSW 2 88525871 missense probably benign 0.07
R8389:Olfr1186 UTSW 2 88525587 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TCTGAGAAGCCACAGTGCAG -3'
(R):5'- TCACAGGTCCTAGATTATTGTTCC -3'

Sequencing Primer
(F):5'- GACGAAAGGCCTTGTCTACATGC -3'
(R):5'- AGGTCCTAGATTATTGTTCCTACAC -3'
Posted On2016-12-20