Incidental Mutation 'R5831:Flg2'
ID449299
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
MMRRC Submission 043220-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5831 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93200234 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 9 (V9I)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
Predicted Effect probably damaging
Transcript: ENSMUST00000098884
AA Change: V9I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: V9I

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,567,777 K4460* probably null Het
Adam21 A G 12: 81,559,101 V629A probably benign Het
Adamts5 C T 16: 85,868,118 V653I probably damaging Het
Adarb2 G A 13: 8,559,133 A44T probably benign Het
Ank2 T C 3: 127,339,159 probably benign Het
Arhgap21 T C 2: 20,863,213 Y833C probably damaging Het
Brwd1 A G 16: 96,019,436 S1297P probably damaging Het
Cdc25b G T 2: 131,187,381 probably null Het
Ciart A T 3: 95,878,902 V287D probably damaging Het
Csf2ra A G 19: 61,225,212 F353S probably damaging Het
D630045J12Rik C T 6: 38,142,657 E1717K possibly damaging Het
Dhcr24 A G 4: 106,564,414 K82R probably benign Het
Dnah9 T A 11: 66,108,121 T1034S probably benign Het
Dock6 T C 9: 21,803,036 E1837G probably damaging Het
Fam102b A T 3: 108,992,703 S110T possibly damaging Het
Hif1a A T 12: 73,942,144 T602S probably benign Het
Hip1 T C 5: 135,411,263 E1015G probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irgq C A 7: 24,533,338 F201L probably damaging Het
Isoc2b C A 7: 4,851,024 L116F probably null Het
Loxl3 A T 6: 83,049,018 T416S probably benign Het
Map3k13 A G 16: 21,928,048 *960W probably null Het
Morn1 A G 4: 155,101,276 H183R probably benign Het
Mrc1 A T 2: 14,308,712 N918I probably damaging Het
Nfxl1 A G 5: 72,522,197 V763A probably benign Het
Olfr1186 G A 2: 88,526,480 W299* probably null Het
Olfr738 A G 14: 50,413,982 probably null Het
Papola A G 12: 105,823,600 K482E probably benign Het
Pck1 C T 2: 173,156,999 T350I probably damaging Het
Peli2 G A 14: 48,168,270 A51T probably damaging Het
Preb T C 5: 30,958,864 H133R probably benign Het
Rpl36-ps4 T C 17: 87,921,257 V73A probably benign Het
Scaf11 G A 15: 96,417,081 P1240L probably benign Het
Selenom G T 11: 3,516,882 E81* probably null Het
Serpinb1c T C 13: 32,897,098 M1V probably null Het
Tanc1 T C 2: 59,785,341 S231P possibly damaging Het
Trappc10 C T 10: 78,209,426 R476Q probably damaging Het
Twf2 T A 9: 106,214,187 D200E probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn2r71 G A 7: 85,623,714 D579N probably benign Het
Vrtn A T 12: 84,648,575 E33V probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- TGACCCATACTTGTATGTTGAGG -3'
(R):5'- GCATGTTCCAACTAATCTGAGAAC -3'

Sequencing Primer
(F):5'- GTGGTCCAACAATGCTGTCACAG -3'
(R):5'- CCAGCAGTTCCTTTAGCT -3'
Posted On2016-12-20