Incidental Mutation 'R5831:Fam102b'
ID449301
Institutional Source Beutler Lab
Gene Symbol Fam102b
Ensembl Gene ENSMUSG00000040339
Gene Namefamily with sequence similarity 102, member B
Synonyms
MMRRC Submission 043220-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5831 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108970997-109027607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108992703 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 110 (S110T)
Ref Sequence ENSEMBL: ENSMUSP00000131904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046924] [ENSMUST00000171143]
Predicted Effect probably benign
Transcript: ENSMUST00000046924
AA Change: S79T

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039751
Gene: ENSMUSG00000040339
AA Change: S79T

DomainStartEndE-ValueType
Pfam:NT-C2 1 118 7.7e-24 PFAM
low complexity region 230 257 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171143
AA Change: S110T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131904
Gene: ENSMUSG00000040339
AA Change: S110T

DomainStartEndE-ValueType
Pfam:NT-C2 3 149 1.3e-31 PFAM
low complexity region 261 288 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,567,777 K4460* probably null Het
Adam21 A G 12: 81,559,101 V629A probably benign Het
Adamts5 C T 16: 85,868,118 V653I probably damaging Het
Adarb2 G A 13: 8,559,133 A44T probably benign Het
Ank2 T C 3: 127,339,159 probably benign Het
Arhgap21 T C 2: 20,863,213 Y833C probably damaging Het
Brwd1 A G 16: 96,019,436 S1297P probably damaging Het
Cdc25b G T 2: 131,187,381 probably null Het
Ciart A T 3: 95,878,902 V287D probably damaging Het
Csf2ra A G 19: 61,225,212 F353S probably damaging Het
D630045J12Rik C T 6: 38,142,657 E1717K possibly damaging Het
Dhcr24 A G 4: 106,564,414 K82R probably benign Het
Dnah9 T A 11: 66,108,121 T1034S probably benign Het
Dock6 T C 9: 21,803,036 E1837G probably damaging Het
Flg2 G A 3: 93,200,234 V9I probably damaging Het
Hif1a A T 12: 73,942,144 T602S probably benign Het
Hip1 T C 5: 135,411,263 E1015G probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irgq C A 7: 24,533,338 F201L probably damaging Het
Isoc2b C A 7: 4,851,024 L116F probably null Het
Loxl3 A T 6: 83,049,018 T416S probably benign Het
Map3k13 A G 16: 21,928,048 *960W probably null Het
Morn1 A G 4: 155,101,276 H183R probably benign Het
Mrc1 A T 2: 14,308,712 N918I probably damaging Het
Nfxl1 A G 5: 72,522,197 V763A probably benign Het
Olfr1186 G A 2: 88,526,480 W299* probably null Het
Olfr738 A G 14: 50,413,982 probably null Het
Papola A G 12: 105,823,600 K482E probably benign Het
Pck1 C T 2: 173,156,999 T350I probably damaging Het
Peli2 G A 14: 48,168,270 A51T probably damaging Het
Preb T C 5: 30,958,864 H133R probably benign Het
Rpl36-ps4 T C 17: 87,921,257 V73A probably benign Het
Scaf11 G A 15: 96,417,081 P1240L probably benign Het
Selenom G T 11: 3,516,882 E81* probably null Het
Serpinb1c T C 13: 32,897,098 M1V probably null Het
Tanc1 T C 2: 59,785,341 S231P possibly damaging Het
Trappc10 C T 10: 78,209,426 R476Q probably damaging Het
Twf2 T A 9: 106,214,187 D200E probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn2r71 G A 7: 85,623,714 D579N probably benign Het
Vrtn A T 12: 84,648,575 E33V probably damaging Het
Other mutations in Fam102b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Fam102b APN 3 108979785 missense possibly damaging 0.94
IGL02415:Fam102b APN 3 108980292 missense probably damaging 1.00
R0362:Fam102b UTSW 3 108980181 missense probably benign 0.37
R0502:Fam102b UTSW 3 108992685 missense probably damaging 1.00
R0505:Fam102b UTSW 3 108980204 missense probably benign 0.00
R0686:Fam102b UTSW 3 108992685 missense probably damaging 1.00
R2568:Fam102b UTSW 3 108978848 missense probably benign 0.09
R3721:Fam102b UTSW 3 108979767 missense probably damaging 1.00
R4466:Fam102b UTSW 3 108979808 missense probably benign 0.31
R4613:Fam102b UTSW 3 109027255 missense probably benign 0.12
R4946:Fam102b UTSW 3 108980228 missense probably benign 0.00
R5182:Fam102b UTSW 3 108985351 missense possibly damaging 0.81
R5930:Fam102b UTSW 3 108980152 missense probably benign 0.00
R7432:Fam102b UTSW 3 109003407 missense probably damaging 0.97
R7601:Fam102b UTSW 3 108988312 missense possibly damaging 0.51
R8309:Fam102b UTSW 3 109027342 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCACTTCTATGGTGTGGAAGGG -3'
(R):5'- TGCTAAAGCAGGTAGCAGC -3'

Sequencing Primer
(F):5'- GCTTATGACCTCAGGATGGATTCC -3'
(R):5'- TGCTAAAGCAGGTAGCAGCAAAAC -3'
Posted On2016-12-20