Incidental Mutation 'R5831:Dhcr24'
ID449304
Institutional Source Beutler Lab
Gene Symbol Dhcr24
Ensembl Gene ENSMUSG00000034926
Gene Name24-dehydrocholesterol reductase
Synonyms2310076D10Rik, seladin-1, 5830417J06Rik, 3-beta-hydroxysterol delta-24 reductase
MMRRC Submission 043220-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock #R5831 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106561038-106589113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106564414 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 82 (K82R)
Ref Sequence ENSEMBL: ENSMUSP00000038063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047973]
Predicted Effect probably benign
Transcript: ENSMUST00000047973
AA Change: K82R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000038063
Gene: ENSMUSG00000034926
AA Change: K82R

DomainStartEndE-ValueType
Pfam:FAD_binding_4 71 203 2e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin adenine dinucleotide (FAD)-dependent oxidoreductase which catalyzes the reduction of the delta-24 double bond of sterol intermediates during cholesterol biosynthesis. The protein contains a leader sequence that directs it to the endoplasmic reticulum membrane. Missense mutations in this gene have been associated with desmosterolosis. Also, reduced expression of the gene occurs in the temporal cortex of Alzheimer disease patients and overexpression has been observed in adrenal gland cancer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of having almost no plasma or tissue cholesterol, homozygous mutant mice are largely viable and display a mild growth phenotype. Inactivation did impair prenatal viability as well as infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,567,777 K4460* probably null Het
Adam21 A G 12: 81,559,101 V629A probably benign Het
Adamts5 C T 16: 85,868,118 V653I probably damaging Het
Adarb2 G A 13: 8,559,133 A44T probably benign Het
Ank2 T C 3: 127,339,159 probably benign Het
Arhgap21 T C 2: 20,863,213 Y833C probably damaging Het
Brwd1 A G 16: 96,019,436 S1297P probably damaging Het
Cdc25b G T 2: 131,187,381 probably null Het
Ciart A T 3: 95,878,902 V287D probably damaging Het
Csf2ra A G 19: 61,225,212 F353S probably damaging Het
D630045J12Rik C T 6: 38,142,657 E1717K possibly damaging Het
Dnah9 T A 11: 66,108,121 T1034S probably benign Het
Dock6 T C 9: 21,803,036 E1837G probably damaging Het
Fam102b A T 3: 108,992,703 S110T possibly damaging Het
Flg2 G A 3: 93,200,234 V9I probably damaging Het
Hif1a A T 12: 73,942,144 T602S probably benign Het
Hip1 T C 5: 135,411,263 E1015G probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irgq C A 7: 24,533,338 F201L probably damaging Het
Isoc2b C A 7: 4,851,024 L116F probably null Het
Loxl3 A T 6: 83,049,018 T416S probably benign Het
Map3k13 A G 16: 21,928,048 *960W probably null Het
Morn1 A G 4: 155,101,276 H183R probably benign Het
Mrc1 A T 2: 14,308,712 N918I probably damaging Het
Nfxl1 A G 5: 72,522,197 V763A probably benign Het
Olfr1186 G A 2: 88,526,480 W299* probably null Het
Olfr738 A G 14: 50,413,982 probably null Het
Papola A G 12: 105,823,600 K482E probably benign Het
Pck1 C T 2: 173,156,999 T350I probably damaging Het
Peli2 G A 14: 48,168,270 A51T probably damaging Het
Preb T C 5: 30,958,864 H133R probably benign Het
Rpl36-ps4 T C 17: 87,921,257 V73A probably benign Het
Scaf11 G A 15: 96,417,081 P1240L probably benign Het
Selenom G T 11: 3,516,882 E81* probably null Het
Serpinb1c T C 13: 32,897,098 M1V probably null Het
Tanc1 T C 2: 59,785,341 S231P possibly damaging Het
Trappc10 C T 10: 78,209,426 R476Q probably damaging Het
Twf2 T A 9: 106,214,187 D200E probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn2r71 G A 7: 85,623,714 D579N probably benign Het
Vrtn A T 12: 84,648,575 E33V probably damaging Het
Other mutations in Dhcr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Dhcr24 APN 4 106572278 missense possibly damaging 0.50
IGL01548:Dhcr24 APN 4 106573871 nonsense probably null
IGL02110:Dhcr24 APN 4 106573801 missense probably damaging 1.00
IGL02256:Dhcr24 APN 4 106572320 missense probably damaging 0.98
IGL02748:Dhcr24 APN 4 106564392 splice site probably benign
IGL02926:Dhcr24 APN 4 106586355 missense probably damaging 0.98
ANU22:Dhcr24 UTSW 4 106572278 missense possibly damaging 0.50
R0423:Dhcr24 UTSW 4 106586536 unclassified probably benign
R1632:Dhcr24 UTSW 4 106585951 missense probably benign
R1771:Dhcr24 UTSW 4 106578253 missense probably benign 0.00
R2138:Dhcr24 UTSW 4 106572302 nonsense probably null
R2139:Dhcr24 UTSW 4 106572302 nonsense probably null
R2420:Dhcr24 UTSW 4 106561094 start gained probably benign
R2422:Dhcr24 UTSW 4 106561094 start gained probably benign
R2570:Dhcr24 UTSW 4 106585832 missense probably benign 0.00
R3176:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3276:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3842:Dhcr24 UTSW 4 106585805 missense probably damaging 1.00
R3852:Dhcr24 UTSW 4 106573873 missense probably benign 0.02
R4037:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4038:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4039:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R7285:Dhcr24 UTSW 4 106571519 critical splice donor site probably null
R7821:Dhcr24 UTSW 4 106571436 missense possibly damaging 0.61
X0057:Dhcr24 UTSW 4 106586345 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGTTGACGTCCTGAGCTAG -3'
(R):5'- AAGAGTCACTCATACCCGGG -3'

Sequencing Primer
(F):5'- CTGAGCTAGGGAGACTGCAC -3'
(R):5'- CAGTGCTAGGTAAATGTAAACGCTCC -3'
Posted On2016-12-20