Incidental Mutation 'R5831:Loxl3'
ID449311
Institutional Source Beutler Lab
Gene Symbol Loxl3
Ensembl Gene ENSMUSG00000000693
Gene Namelysyl oxidase-like 3
SynonymsLor2
MMRRC Submission 043220-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R5831 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83034173-83052562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83049018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 416 (T416S)
Ref Sequence ENSEMBL: ENSMUSP00000000707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000089645] [ENSMUST00000101257] [ENSMUST00000113962] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000134606]
Predicted Effect probably benign
Transcript: ENSMUST00000000707
AA Change: T416S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693
AA Change: T416S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089645
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101257
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113962
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113963
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132099
Predicted Effect probably benign
Transcript: ENSMUST00000134606
SMART Domains Protein: ENSMUSP00000115547
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
Pfam:Trypsin 7 180 2.7e-15 PFAM
Pfam:Trypsin_2 20 158 3.1e-24 PFAM
PDZ 209 283 2.86e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144058
Predicted Effect probably benign
Transcript: ENSMUST00000150217
SMART Domains Protein: ENSMUSP00000118234
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Trypsin 41 215 1.6e-11 PFAM
Pfam:Trypsin_2 53 190 1.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204318
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysyl oxidase, which likely functions as an amine oxidase and plays a role in the formation of crosslinks in collagens and elastin. Deletion of the related gene in mouse causes neonatal mortality with cleft palate, spine deformity, and defects in collagen organization. A mutation in this gene was found in a family with Stickler syndrome. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality shortly after birth, craniofacial and vertebral abnormalities associated with collagen deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,567,777 K4460* probably null Het
Adam21 A G 12: 81,559,101 V629A probably benign Het
Adamts5 C T 16: 85,868,118 V653I probably damaging Het
Adarb2 G A 13: 8,559,133 A44T probably benign Het
Ank2 T C 3: 127,339,159 probably benign Het
Arhgap21 T C 2: 20,863,213 Y833C probably damaging Het
Brwd1 A G 16: 96,019,436 S1297P probably damaging Het
Cdc25b G T 2: 131,187,381 probably null Het
Ciart A T 3: 95,878,902 V287D probably damaging Het
Csf2ra A G 19: 61,225,212 F353S probably damaging Het
D630045J12Rik C T 6: 38,142,657 E1717K possibly damaging Het
Dhcr24 A G 4: 106,564,414 K82R probably benign Het
Dnah9 T A 11: 66,108,121 T1034S probably benign Het
Dock6 T C 9: 21,803,036 E1837G probably damaging Het
Fam102b A T 3: 108,992,703 S110T possibly damaging Het
Flg2 G A 3: 93,200,234 V9I probably damaging Het
Hif1a A T 12: 73,942,144 T602S probably benign Het
Hip1 T C 5: 135,411,263 E1015G probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irgq C A 7: 24,533,338 F201L probably damaging Het
Isoc2b C A 7: 4,851,024 L116F probably null Het
Map3k13 A G 16: 21,928,048 *960W probably null Het
Morn1 A G 4: 155,101,276 H183R probably benign Het
Mrc1 A T 2: 14,308,712 N918I probably damaging Het
Nfxl1 A G 5: 72,522,197 V763A probably benign Het
Olfr1186 G A 2: 88,526,480 W299* probably null Het
Olfr738 A G 14: 50,413,982 probably null Het
Papola A G 12: 105,823,600 K482E probably benign Het
Pck1 C T 2: 173,156,999 T350I probably damaging Het
Peli2 G A 14: 48,168,270 A51T probably damaging Het
Preb T C 5: 30,958,864 H133R probably benign Het
Rpl36-ps4 T C 17: 87,921,257 V73A probably benign Het
Scaf11 G A 15: 96,417,081 P1240L probably benign Het
Selenom G T 11: 3,516,882 E81* probably null Het
Serpinb1c T C 13: 32,897,098 M1V probably null Het
Tanc1 T C 2: 59,785,341 S231P possibly damaging Het
Trappc10 C T 10: 78,209,426 R476Q probably damaging Het
Twf2 T A 9: 106,214,187 D200E probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn2r71 G A 7: 85,623,714 D579N probably benign Het
Vrtn A T 12: 84,648,575 E33V probably damaging Het
Other mutations in Loxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Loxl3 APN 6 83048766 unclassified probably benign
IGL01370:Loxl3 APN 6 83049487 missense probably damaging 1.00
IGL02126:Loxl3 APN 6 83048647 missense probably damaging 1.00
IGL02128:Loxl3 APN 6 83050583 missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83050133 missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83050133 missense probably damaging 1.00
R1725:Loxl3 UTSW 6 83035593 missense probably benign 0.00
R1771:Loxl3 UTSW 6 83049909 missense probably damaging 1.00
R2017:Loxl3 UTSW 6 83048977 missense probably damaging 0.99
R2291:Loxl3 UTSW 6 83037488 missense probably benign 0.07
R3731:Loxl3 UTSW 6 83050671 critical splice donor site probably null
R4179:Loxl3 UTSW 6 83037584 missense probably benign 0.00
R5230:Loxl3 UTSW 6 83035794 missense probably benign 0.16
R5385:Loxl3 UTSW 6 83050612 missense probably damaging 0.99
R5591:Loxl3 UTSW 6 83048037 missense probably damaging 1.00
R5664:Loxl3 UTSW 6 83049882 missense probably benign 0.12
R5769:Loxl3 UTSW 6 83050600 missense probably damaging 0.98
R5771:Loxl3 UTSW 6 83035799 splice site probably null
R5802:Loxl3 UTSW 6 83049289 missense possibly damaging 0.67
R5945:Loxl3 UTSW 6 83037511 missense probably damaging 1.00
R6542:Loxl3 UTSW 6 83048166 missense probably benign 0.00
R6687:Loxl3 UTSW 6 83050664 missense probably damaging 1.00
R7961:Loxl3 UTSW 6 83050809 missense possibly damaging 0.88
R8009:Loxl3 UTSW 6 83050809 missense possibly damaging 0.88
R8122:Loxl3 UTSW 6 83049259 missense probably damaging 1.00
R8278:Loxl3 UTSW 6 83048716 missense probably damaging 1.00
R8373:Loxl3 UTSW 6 83048891 missense possibly damaging 0.89
R8411:Loxl3 UTSW 6 83050624 missense probably damaging 1.00
V1024:Loxl3 UTSW 6 83035738 missense probably damaging 1.00
X0009:Loxl3 UTSW 6 83038480 missense probably damaging 1.00
Z1177:Loxl3 UTSW 6 83038578 nonsense probably null
Z1177:Loxl3 UTSW 6 83048160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGGGAAGGTATGGAGTCCTC -3'
(R):5'- CCACTGAGTCGGATCTGTAGAG -3'

Sequencing Primer
(F):5'- CTGGGCAATGGTCTAGTTCCAAC -3'
(R):5'- ACTGAGTCGGATCTGTAGAGGTATAG -3'
Posted On2016-12-20