Incidental Mutation 'R5831:Vmn2r71'
ID449314
Institutional Source Beutler Lab
Gene Symbol Vmn2r71
Ensembl Gene ENSMUSG00000091205
Gene Namevomeronasal 2, receptor 71
SynonymsEG233445
MMRRC Submission 043220-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5831 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location85574614-85624547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85623714 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 579 (D579N)
Ref Sequence ENSEMBL: ENSMUSP00000132337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172338]
Predicted Effect probably benign
Transcript: ENSMUST00000172338
AA Change: D579N

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132337
Gene: ENSMUSG00000091205
AA Change: D579N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.1e-31 PFAM
Pfam:NCD3G 511 563 8.7e-20 PFAM
Pfam:7tm_3 593 831 2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208273
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,567,777 K4460* probably null Het
Adam21 A G 12: 81,559,101 V629A probably benign Het
Adamts5 C T 16: 85,868,118 V653I probably damaging Het
Adarb2 G A 13: 8,559,133 A44T probably benign Het
Ank2 T C 3: 127,339,159 probably benign Het
Arhgap21 T C 2: 20,863,213 Y833C probably damaging Het
Brwd1 A G 16: 96,019,436 S1297P probably damaging Het
Cdc25b G T 2: 131,187,381 probably null Het
Ciart A T 3: 95,878,902 V287D probably damaging Het
Csf2ra A G 19: 61,225,212 F353S probably damaging Het
D630045J12Rik C T 6: 38,142,657 E1717K possibly damaging Het
Dhcr24 A G 4: 106,564,414 K82R probably benign Het
Dnah9 T A 11: 66,108,121 T1034S probably benign Het
Dock6 T C 9: 21,803,036 E1837G probably damaging Het
Fam102b A T 3: 108,992,703 S110T possibly damaging Het
Flg2 G A 3: 93,200,234 V9I probably damaging Het
Hif1a A T 12: 73,942,144 T602S probably benign Het
Hip1 T C 5: 135,411,263 E1015G probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irgq C A 7: 24,533,338 F201L probably damaging Het
Isoc2b C A 7: 4,851,024 L116F probably null Het
Loxl3 A T 6: 83,049,018 T416S probably benign Het
Map3k13 A G 16: 21,928,048 *960W probably null Het
Morn1 A G 4: 155,101,276 H183R probably benign Het
Mrc1 A T 2: 14,308,712 N918I probably damaging Het
Nfxl1 A G 5: 72,522,197 V763A probably benign Het
Olfr1186 G A 2: 88,526,480 W299* probably null Het
Olfr738 A G 14: 50,413,982 probably null Het
Papola A G 12: 105,823,600 K482E probably benign Het
Pck1 C T 2: 173,156,999 T350I probably damaging Het
Peli2 G A 14: 48,168,270 A51T probably damaging Het
Preb T C 5: 30,958,864 H133R probably benign Het
Rpl36-ps4 T C 17: 87,921,257 V73A probably benign Het
Scaf11 G A 15: 96,417,081 P1240L probably benign Het
Selenom G T 11: 3,516,882 E81* probably null Het
Serpinb1c T C 13: 32,897,098 M1V probably null Het
Tanc1 T C 2: 59,785,341 S231P possibly damaging Het
Trappc10 C T 10: 78,209,426 R476Q probably damaging Het
Twf2 T A 9: 106,214,187 D200E probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vrtn A T 12: 84,648,575 E33V probably damaging Het
Other mutations in Vmn2r71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Vmn2r71 APN 7 85618693 missense probably benign
IGL00960:Vmn2r71 APN 7 85624374 missense probably damaging 1.00
IGL01372:Vmn2r71 APN 7 85620814 splice site probably benign
IGL01690:Vmn2r71 APN 7 85615574 missense probably damaging 1.00
IGL01909:Vmn2r71 APN 7 85620793 missense probably benign 0.00
IGL01950:Vmn2r71 APN 7 85615619 missense probably damaging 0.98
IGL02570:Vmn2r71 APN 7 85615540 missense possibly damaging 0.95
IGL02650:Vmn2r71 APN 7 85624327 missense probably damaging 1.00
IGL02901:Vmn2r71 APN 7 85619262 missense probably benign 0.00
IGL03128:Vmn2r71 APN 7 85619587 missense probably damaging 1.00
IGL03328:Vmn2r71 APN 7 85624291 missense probably damaging 1.00
R0533:Vmn2r71 UTSW 7 85619218 frame shift probably null
R0707:Vmn2r71 UTSW 7 85619432 missense probably benign
R0841:Vmn2r71 UTSW 7 85618541 missense possibly damaging 0.62
R0865:Vmn2r71 UTSW 7 85619308 missense probably benign 0.01
R0883:Vmn2r71 UTSW 7 85623634 missense probably benign 0.19
R0939:Vmn2r71 UTSW 7 85623681 missense possibly damaging 0.70
R1597:Vmn2r71 UTSW 7 85624144 missense possibly damaging 0.46
R1646:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R1719:Vmn2r71 UTSW 7 85621227 missense probably damaging 1.00
R1860:Vmn2r71 UTSW 7 85615574 missense probably damaging 1.00
R2013:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2014:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2015:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2050:Vmn2r71 UTSW 7 85624473 missense probably damaging 1.00
R2084:Vmn2r71 UTSW 7 85618737 missense probably benign 0.03
R2221:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2223:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2245:Vmn2r71 UTSW 7 85624180 missense probably damaging 1.00
R3115:Vmn2r71 UTSW 7 85623658 missense probably damaging 0.97
R3122:Vmn2r71 UTSW 7 85615620 nonsense probably null
R3609:Vmn2r71 UTSW 7 85619662 missense probably damaging 1.00
R4093:Vmn2r71 UTSW 7 85621234 missense probably benign 0.00
R4305:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4306:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4334:Vmn2r71 UTSW 7 85619834 missense probably benign 0.01
R4569:Vmn2r71 UTSW 7 85624194 missense possibly damaging 0.66
R4622:Vmn2r71 UTSW 7 85620609 missense probably benign 0.00
R4915:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R4956:Vmn2r71 UTSW 7 85619228 missense probably benign 0.19
R5005:Vmn2r71 UTSW 7 85624144 missense probably damaging 1.00
R5045:Vmn2r71 UTSW 7 85624389 missense probably benign 0.00
R5153:Vmn2r71 UTSW 7 85619222 missense possibly damaging 0.94
R5236:Vmn2r71 UTSW 7 85623669 missense probably damaging 1.00
R5373:Vmn2r71 UTSW 7 85618542 missense possibly damaging 0.79
R5405:Vmn2r71 UTSW 7 85619414 missense probably benign
R6061:Vmn2r71 UTSW 7 85619274 missense probably benign
R6518:Vmn2r71 UTSW 7 85621228 missense probably damaging 1.00
R6751:Vmn2r71 UTSW 7 85619887 critical splice donor site probably null
R6920:Vmn2r71 UTSW 7 85623900 missense probably damaging 1.00
R7358:Vmn2r71 UTSW 7 85624260 missense possibly damaging 0.81
R7453:Vmn2r71 UTSW 7 85624089 missense probably benign 0.21
R7560:Vmn2r71 UTSW 7 85623907 missense probably benign 0.06
X0025:Vmn2r71 UTSW 7 85618665 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATGAATGGTCAAGATAAGATATGCG -3'
(R):5'- CAGGTGACCATAGTGGGATG -3'

Sequencing Primer
(F):5'- CAAAAGCATTCATGAAGATGATAAGC -3'
(R):5'- TGACCAATGTAAAGCAAGGAAC -3'
Posted On2016-12-20