Incidental Mutation 'R5831:Dock6'
ID449316
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 043220-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R5831 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21803036 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1837 (E1837G)
Ref Sequence ENSEMBL: ENSMUSP00000149156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034717] [ENSMUST00000034728] [ENSMUST00000213691] [ENSMUST00000216008] [ENSMUST00000217336]
Predicted Effect probably benign
Transcript: ENSMUST00000034717
SMART Domains Protein: ENSMUSP00000034717
Gene: ENSMUSG00000032194

DomainStartEndE-ValueType
Pfam:KN_motif 31 69 9.6e-26 PFAM
low complexity region 139 157 N/A INTRINSIC
coiled coil region 213 229 N/A INTRINSIC
coiled coil region 284 316 N/A INTRINSIC
low complexity region 324 343 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
ANK 658 688 6.36e-3 SMART
ANK 692 725 7.29e2 SMART
ANK 730 759 4.97e-5 SMART
ANK 763 793 3.85e-2 SMART
ANK 797 825 1.06e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000034728
AA Change: E1806G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: E1806G

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213691
Predicted Effect unknown
Transcript: ENSMUST00000215729
AA Change: N551D
Predicted Effect probably benign
Transcript: ENSMUST00000216008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217310
Predicted Effect probably damaging
Transcript: ENSMUST00000217336
AA Change: E1837G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,567,777 K4460* probably null Het
Adam21 A G 12: 81,559,101 V629A probably benign Het
Adamts5 C T 16: 85,868,118 V653I probably damaging Het
Adarb2 G A 13: 8,559,133 A44T probably benign Het
Ank2 T C 3: 127,339,159 probably benign Het
Arhgap21 T C 2: 20,863,213 Y833C probably damaging Het
Brwd1 A G 16: 96,019,436 S1297P probably damaging Het
Cdc25b G T 2: 131,187,381 probably null Het
Ciart A T 3: 95,878,902 V287D probably damaging Het
Csf2ra A G 19: 61,225,212 F353S probably damaging Het
D630045J12Rik C T 6: 38,142,657 E1717K possibly damaging Het
Dhcr24 A G 4: 106,564,414 K82R probably benign Het
Dnah9 T A 11: 66,108,121 T1034S probably benign Het
Fam102b A T 3: 108,992,703 S110T possibly damaging Het
Flg2 G A 3: 93,200,234 V9I probably damaging Het
Hif1a A T 12: 73,942,144 T602S probably benign Het
Hip1 T C 5: 135,411,263 E1015G probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irgq C A 7: 24,533,338 F201L probably damaging Het
Isoc2b C A 7: 4,851,024 L116F probably null Het
Loxl3 A T 6: 83,049,018 T416S probably benign Het
Map3k13 A G 16: 21,928,048 *960W probably null Het
Morn1 A G 4: 155,101,276 H183R probably benign Het
Mrc1 A T 2: 14,308,712 N918I probably damaging Het
Nfxl1 A G 5: 72,522,197 V763A probably benign Het
Olfr1186 G A 2: 88,526,480 W299* probably null Het
Olfr738 A G 14: 50,413,982 probably null Het
Papola A G 12: 105,823,600 K482E probably benign Het
Pck1 C T 2: 173,156,999 T350I probably damaging Het
Peli2 G A 14: 48,168,270 A51T probably damaging Het
Preb T C 5: 30,958,864 H133R probably benign Het
Rpl36-ps4 T C 17: 87,921,257 V73A probably benign Het
Scaf11 G A 15: 96,417,081 P1240L probably benign Het
Selenom G T 11: 3,516,882 E81* probably null Het
Serpinb1c T C 13: 32,897,098 M1V probably null Het
Tanc1 T C 2: 59,785,341 S231P possibly damaging Het
Trappc10 C T 10: 78,209,426 R476Q probably damaging Het
Twf2 T A 9: 106,214,187 D200E probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn2r71 G A 7: 85,623,714 D579N probably benign Het
Vrtn A T 12: 84,648,575 E33V probably damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGCTTGGACTTGTCCACTG -3'
(R):5'- TGTCTGAGATCCCCAGACAG -3'

Sequencing Primer
(F):5'- ACTTGTCCACTGGGTTAGAATC -3'
(R):5'- AGACAGGCTCCTGAGGTTCAG -3'
Posted On2016-12-20