Incidental Mutation 'R5831:Map3k13'
ID 449335
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms C130026N12Rik
MMRRC Submission 043220-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5831 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 21643923-21752189 bp(+) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) A to G at 21746798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 960 (*960W)
Ref Sequence ENSEMBL: ENSMUSP00000156202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect probably null
Transcript: ENSMUST00000042065
AA Change: *960W
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: *960W

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000231988
AA Change: *960W
Predicted Effect probably null
Transcript: ENSMUST00000232240
AA Change: *960W
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,517,777 (GRCm39) K4460* probably null Het
Adam21 A G 12: 81,605,875 (GRCm39) V629A probably benign Het
Adamts5 C T 16: 85,665,006 (GRCm39) V653I probably damaging Het
Adarb2 G A 13: 8,609,169 (GRCm39) A44T probably benign Het
Ank2 T C 3: 127,132,808 (GRCm39) probably benign Het
Arhgap21 T C 2: 20,868,024 (GRCm39) Y833C probably damaging Het
Brwd1 A G 16: 95,820,636 (GRCm39) S1297P probably damaging Het
Cdc25b G T 2: 131,029,301 (GRCm39) probably null Het
Ciart A T 3: 95,786,214 (GRCm39) V287D probably damaging Het
Csf2ra A G 19: 61,213,650 (GRCm39) F353S probably damaging Het
D630045J12Rik C T 6: 38,119,592 (GRCm39) E1717K possibly damaging Het
Dhcr24 A G 4: 106,421,611 (GRCm39) K82R probably benign Het
Dnah9 T A 11: 65,998,947 (GRCm39) T1034S probably benign Het
Dock6 T C 9: 21,714,332 (GRCm39) E1837G probably damaging Het
Eeig2 A T 3: 108,900,019 (GRCm39) S110T possibly damaging Het
Flg2 G A 3: 93,107,541 (GRCm39) V9I probably damaging Het
Hif1a A T 12: 73,988,918 (GRCm39) T602S probably benign Het
Hip1 T C 5: 135,440,117 (GRCm39) E1015G probably benign Het
Iqgap2 C T 13: 95,811,880 (GRCm39) R707H probably damaging Het
Irgq C A 7: 24,232,763 (GRCm39) F201L probably damaging Het
Isoc2b C A 7: 4,854,023 (GRCm39) L116F probably null Het
Loxl3 A T 6: 83,025,999 (GRCm39) T416S probably benign Het
Morn1 A G 4: 155,185,733 (GRCm39) H183R probably benign Het
Mrc1 A T 2: 14,313,523 (GRCm39) N918I probably damaging Het
Nfxl1 A G 5: 72,679,540 (GRCm39) V763A probably benign Het
Or11g1 A G 14: 50,651,439 (GRCm39) probably null Het
Or4c100 G A 2: 88,356,824 (GRCm39) W299* probably null Het
Papola A G 12: 105,789,859 (GRCm39) K482E probably benign Het
Pck1 C T 2: 172,998,792 (GRCm39) T350I probably damaging Het
Peli2 G A 14: 48,405,727 (GRCm39) A51T probably damaging Het
Preb T C 5: 31,116,208 (GRCm39) H133R probably benign Het
Rpl36-ps4 T C 17: 88,228,685 (GRCm39) V73A probably benign Het
Scaf11 G A 15: 96,314,962 (GRCm39) P1240L probably benign Het
Selenom G T 11: 3,466,882 (GRCm39) E81* probably null Het
Serpinb1c T C 13: 33,081,081 (GRCm39) M1V probably null Het
Tanc1 T C 2: 59,615,685 (GRCm39) S231P possibly damaging Het
Trappc10 C T 10: 78,045,260 (GRCm39) R476Q probably damaging Het
Twf2 T A 9: 106,091,386 (GRCm39) D200E probably benign Het
Vmn1r17 T C 6: 57,337,999 (GRCm39) Y122C probably benign Het
Vmn2r71 G A 7: 85,272,922 (GRCm39) D579N probably benign Het
Vrtn A T 12: 84,695,349 (GRCm39) E33V probably damaging Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21,740,514 (GRCm39) missense probably benign 0.00
IGL01092:Map3k13 APN 16 21,746,766 (GRCm39) missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21,710,873 (GRCm39) missense probably benign
IGL02444:Map3k13 APN 16 21,732,982 (GRCm39) missense probably benign 0.19
IGL02503:Map3k13 APN 16 21,727,454 (GRCm39) missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21,724,005 (GRCm39) missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21,710,981 (GRCm39) missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21,732,975 (GRCm39) missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21,722,506 (GRCm39) missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21,732,907 (GRCm39) missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21,710,738 (GRCm39) missense probably benign
R0601:Map3k13 UTSW 16 21,723,999 (GRCm39) missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21,725,274 (GRCm39) missense probably benign 0.03
R0918:Map3k13 UTSW 16 21,744,990 (GRCm39) missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21,722,542 (GRCm39) missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21,732,939 (GRCm39) missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21,729,836 (GRCm39) missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21,710,894 (GRCm39) missense probably benign 0.01
R2332:Map3k13 UTSW 16 21,717,427 (GRCm39) splice site probably null
R2361:Map3k13 UTSW 16 21,725,286 (GRCm39) missense probably benign 0.05
R4395:Map3k13 UTSW 16 21,717,321 (GRCm39) missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4506:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4521:Map3k13 UTSW 16 21,724,525 (GRCm39) missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21,710,752 (GRCm39) missense probably benign
R4952:Map3k13 UTSW 16 21,729,769 (GRCm39) missense probably benign 0.15
R5035:Map3k13 UTSW 16 21,740,421 (GRCm39) missense probably benign 0.03
R5327:Map3k13 UTSW 16 21,740,397 (GRCm39) missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21,717,391 (GRCm39) missense possibly damaging 0.68
R5996:Map3k13 UTSW 16 21,723,995 (GRCm39) missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21,723,933 (GRCm39) missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21,740,527 (GRCm39) missense probably benign 0.15
R6620:Map3k13 UTSW 16 21,711,061 (GRCm39) missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21,711,062 (GRCm39) missense probably benign 0.32
R6692:Map3k13 UTSW 16 21,723,987 (GRCm39) missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21,741,028 (GRCm39) missense probably benign 0.10
R6743:Map3k13 UTSW 16 21,711,173 (GRCm39) missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21,741,013 (GRCm39) missense probably benign 0.00
R6965:Map3k13 UTSW 16 21,740,900 (GRCm39) missense probably benign
R7149:Map3k13 UTSW 16 21,744,187 (GRCm39) missense probably benign 0.04
R7174:Map3k13 UTSW 16 21,745,006 (GRCm39) missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21,710,988 (GRCm39) missense probably benign 0.03
R7400:Map3k13 UTSW 16 21,741,072 (GRCm39) missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21,740,436 (GRCm39) missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21,724,621 (GRCm39) missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21,740,346 (GRCm39) missense probably benign 0.09
R7876:Map3k13 UTSW 16 21,741,069 (GRCm39) missense probably benign 0.00
R8002:Map3k13 UTSW 16 21,723,878 (GRCm39) missense probably benign 0.05
R8089:Map3k13 UTSW 16 21,722,567 (GRCm39) missense possibly damaging 0.48
R8341:Map3k13 UTSW 16 21,740,334 (GRCm39) nonsense probably null
R8738:Map3k13 UTSW 16 21,745,008 (GRCm39) missense probably damaging 1.00
R8940:Map3k13 UTSW 16 21,727,454 (GRCm39) missense possibly damaging 0.50
R8949:Map3k13 UTSW 16 21,723,882 (GRCm39) missense probably benign 0.05
R9391:Map3k13 UTSW 16 21,740,665 (GRCm39) missense probably benign 0.00
R9749:Map3k13 UTSW 16 21,740,581 (GRCm39) missense probably benign 0.00
R9802:Map3k13 UTSW 16 21,740,518 (GRCm39) missense possibly damaging 0.85
Z1176:Map3k13 UTSW 16 21,723,912 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGTTGAGCTCACCTTC -3'
(R):5'- TCCCTGCCATTCTTGATTGAAATG -3'

Sequencing Primer
(F):5'- GCTGTCACATGCAAAGTGTTCAG -3'
(R):5'- CTTGATTGAAATGCTCAGTGAGACG -3'
Posted On 2016-12-20