Incidental Mutation 'R5832:Pttg1ip'
ID449362
Institutional Source Beutler Lab
Gene Symbol Pttg1ip
Ensembl Gene ENSMUSG00000009291
Gene Namepituitary tumor-transforming 1 interacting protein
Synonyms
MMRRC Submission 044054-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5832 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location77581720-77598732 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 77584025 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009435] [ENSMUST00000161165] [ENSMUST00000161165] [ENSMUST00000161789] [ENSMUST00000162429] [ENSMUST00000162598] [ENSMUST00000162943]
Predicted Effect probably benign
Transcript: ENSMUST00000009435
SMART Domains Protein: ENSMUSP00000009435
Gene: ENSMUSG00000009291

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
PSI 36 89 2.34e-4 SMART
transmembrane domain 94 116 N/A INTRINSIC
coiled coil region 127 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159116
Predicted Effect probably null
Transcript: ENSMUST00000161165
SMART Domains Protein: ENSMUSP00000124774
Gene: ENSMUSG00000009291

DomainStartEndE-ValueType
PSI 7 60 2.34e-4 SMART
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161165
SMART Domains Protein: ENSMUSP00000124774
Gene: ENSMUSG00000009291

DomainStartEndE-ValueType
PSI 7 60 2.34e-4 SMART
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161789
Predicted Effect probably benign
Transcript: ENSMUST00000162429
SMART Domains Protein: ENSMUSP00000124457
Gene: ENSMUSG00000009291

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
coiled coil region 73 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162598
Predicted Effect probably benign
Transcript: ENSMUST00000162943
SMART Domains Protein: ENSMUSP00000124313
Gene: ENSMUSG00000009291

DomainStartEndE-ValueType
Blast:PSI 1 26 2e-11 BLAST
transmembrane domain 31 53 N/A INTRINSIC
coiled coil region 64 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218797
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I integral membrane protein, which binds to pituitary tumor-transforming 1 protein (PTTG1), and facilitates translocation of PTTG1 into the nucleus. Coexpression of this protein and PTTG1 induces transcriptional activation of basic fibroblast growth factor. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adgrv1 G A 13: 81,103,302 S6232F possibly damaging Het
Alox12 T C 11: 70,253,280 E129G probably damaging Het
Anxa13 C A 15: 58,341,993 noncoding transcript Het
Arfgef3 C T 10: 18,630,420 G878D probably damaging Het
Asnsd1 T C 1: 53,347,475 D331G probably damaging Het
Crisp1 A G 17: 40,301,317 probably null Het
Eml5 T C 12: 98,876,188 N217S probably benign Het
Fat1 A T 8: 45,017,423 Y1463F possibly damaging Het
Fhod3 T C 18: 25,090,695 W1033R probably damaging Het
Galr2 T A 11: 116,281,631 L49Q probably damaging Het
Gstm5 T C 3: 107,897,537 V115A probably benign Het
Gtpbp2 C T 17: 46,167,862 T535I probably damaging Het
Hk1 T C 10: 62,292,365 E326G probably benign Het
Igfn1 A G 1: 135,974,795 V388A probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kitl C A 10: 100,080,020 P137H probably damaging Het
Lamp3 A T 16: 19,701,320 Y38N probably damaging Het
Lmo7 A T 14: 101,884,213 N5I probably damaging Het
Mc3r T A 2: 172,249,430 C191S probably benign Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mybpc3 A G 2: 91,119,175 probably null Het
Nav2 A T 7: 49,548,069 probably null Het
Patz1 C T 11: 3,306,277 P521L probably benign Het
Pramef17 A G 4: 143,991,962 S304P probably damaging Het
Prkcd T C 14: 30,605,821 T103A probably damaging Het
Rcbtb2 C A 14: 73,166,822 Q85K possibly damaging Het
Rdh16f1 T A 10: 127,788,749 V152E probably damaging Het
Rsph4a A G 10: 33,909,502 I470V probably benign Het
Sarnp T C 10: 128,848,312 probably null Het
Slc39a6 C A 18: 24,601,612 V7L possibly damaging Het
Slco1a4 A G 6: 141,819,544 I324T probably benign Het
Spata31d1a A T 13: 59,701,566 V916E probably damaging Het
Srgap1 T G 10: 121,840,914 T392P probably damaging Het
Tbc1d20 A T 2: 152,311,362 M271L possibly damaging Het
Tbc1d22b T C 17: 29,570,647 I161T possibly damaging Het
Tcof1 G T 18: 60,819,539 N918K unknown Het
Tnr A G 1: 159,886,122 T707A probably benign Het
Trim66 A G 7: 109,455,202 F1267S probably damaging Het
Trpm6 A G 19: 18,786,819 H263R possibly damaging Het
Tshz2 T A 2: 169,884,045 V187D possibly damaging Het
Ube2f T G 1: 91,285,324 V176G possibly damaging Het
Vmn2r109 C T 17: 20,541,056 A680T probably benign Het
Vmn2r77 T A 7: 86,811,462 C665* probably null Het
Zfp954 A G 7: 7,115,390 V385A probably damaging Het
Other mutations in Pttg1ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Pttg1ip APN 10 77581929 critical splice donor site probably null
IGL02135:Pttg1ip APN 10 77589744 critical splice donor site probably null
IGL02284:Pttg1ip APN 10 77587262 missense probably benign 0.00
R4512:Pttg1ip UTSW 10 77597068 utr 3 prime probably benign
R4969:Pttg1ip UTSW 10 77584020 nonsense probably null
R5891:Pttg1ip UTSW 10 77582440 start gained probably benign
R6188:Pttg1ip UTSW 10 77582508 critical splice donor site probably null
R7565:Pttg1ip UTSW 10 77597036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGTGATCAGCATTGAGAAACC -3'
(R):5'- ACAATGTCCCCGGAATGACG -3'

Sequencing Primer
(F):5'- AAGGACATTGTTCCTATCTCCAGTG -3'
(R):5'- AATGACGAGGTCCGGATCTGTTAC -3'
Posted On2016-12-20