Incidental Mutation 'R5832:Kitl'
ID 449363
Institutional Source Beutler Lab
Gene Symbol Kitl
Ensembl Gene ENSMUSG00000019966
Gene Name kit ligand
Synonyms Gb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor
MMRRC Submission 044054-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.361) question?
Stock # R5832 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 100015630-100100416 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100080020 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Histidine at position 137 (P137H)
Ref Sequence ENSEMBL: ENSMUSP00000100920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000130190] [ENSMUST00000218200]
AlphaFold P20826
Predicted Effect probably damaging
Transcript: ENSMUST00000020129
AA Change: P137H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966
AA Change: P137H

DomainStartEndE-ValueType
Pfam:SCF 1 176 5.7e-102 PFAM
Pfam:SCF 173 245 1.7e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105283
AA Change: P137H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966
AA Change: P137H

DomainStartEndE-ValueType
Pfam:SCF 1 273 2.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130190
SMART Domains Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 43 160 1.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218200
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adgrv1 G A 13: 81,103,302 S6232F possibly damaging Het
Alox12 T C 11: 70,253,280 E129G probably damaging Het
Anxa13 C A 15: 58,341,993 noncoding transcript Het
Arfgef3 C T 10: 18,630,420 G878D probably damaging Het
Asnsd1 T C 1: 53,347,475 D331G probably damaging Het
Crisp1 A G 17: 40,301,317 probably null Het
Eml5 T C 12: 98,876,188 N217S probably benign Het
Fat1 A T 8: 45,017,423 Y1463F possibly damaging Het
Fhod3 T C 18: 25,090,695 W1033R probably damaging Het
Galr2 T A 11: 116,281,631 L49Q probably damaging Het
Gstm5 T C 3: 107,897,537 V115A probably benign Het
Gtpbp2 C T 17: 46,167,862 T535I probably damaging Het
Hk1 T C 10: 62,292,365 E326G probably benign Het
Igfn1 A G 1: 135,974,795 V388A probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Lamp3 A T 16: 19,701,320 Y38N probably damaging Het
Lmo7 A T 14: 101,884,213 N5I probably damaging Het
Mc3r T A 2: 172,249,430 C191S probably benign Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mybpc3 A G 2: 91,119,175 probably null Het
Nav2 A T 7: 49,548,069 probably null Het
Patz1 C T 11: 3,306,277 P521L probably benign Het
Pramef17 A G 4: 143,991,962 S304P probably damaging Het
Prkcd T C 14: 30,605,821 T103A probably damaging Het
Pttg1ip T C 10: 77,584,025 probably null Het
Rcbtb2 C A 14: 73,166,822 Q85K possibly damaging Het
Rdh16f1 T A 10: 127,788,749 V152E probably damaging Het
Rsph4a A G 10: 33,909,502 I470V probably benign Het
Sarnp T C 10: 128,848,312 probably null Het
Slc39a6 C A 18: 24,601,612 V7L possibly damaging Het
Slco1a4 A G 6: 141,819,544 I324T probably benign Het
Spata31d1a A T 13: 59,701,566 V916E probably damaging Het
Srgap1 T G 10: 121,840,914 T392P probably damaging Het
Tbc1d20 A T 2: 152,311,362 M271L possibly damaging Het
Tbc1d22b T C 17: 29,570,647 I161T possibly damaging Het
Tcof1 G T 18: 60,819,539 N918K unknown Het
Tnr A G 1: 159,886,122 T707A probably benign Het
Trim66 A G 7: 109,455,202 F1267S probably damaging Het
Trpm6 A G 19: 18,786,819 H263R possibly damaging Het
Tshz2 T A 2: 169,884,045 V187D possibly damaging Het
Ube2f T G 1: 91,285,324 V176G possibly damaging Het
Vmn2r109 C T 17: 20,541,056 A680T probably benign Het
Vmn2r77 T A 7: 86,811,462 C665* probably null Het
Zfp954 A G 7: 7,115,390 V385A probably damaging Het
Other mutations in Kitl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Kitl APN 10 100087344 splice site probably benign
IGL02066:Kitl APN 10 100076882 missense probably damaging 1.00
IGL03211:Kitl APN 10 100080859 missense probably benign 0.19
Gregory UTSW 10 100076906 critical splice donor site probably null
mooyah UTSW 10 100088222 critical splice donor site probably null
Sandycheeks UTSW 10 100076906 critical splice donor site probably null
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0132:Kitl UTSW 10 100087364 missense probably benign 0.11
R1554:Kitl UTSW 10 100087438 missense probably benign 0.38
R1649:Kitl UTSW 10 100064114 missense probably benign 0.03
R2194:Kitl UTSW 10 100016037 critical splice donor site probably null
R2254:Kitl UTSW 10 100080131 critical splice donor site probably null
R4877:Kitl UTSW 10 100080866 missense probably damaging 1.00
R5135:Kitl UTSW 10 100088222 critical splice donor site probably null
R5453:Kitl UTSW 10 100087385 missense probably damaging 1.00
R5564:Kitl UTSW 10 100080024 missense possibly damaging 0.89
R5971:Kitl UTSW 10 100076906 critical splice donor site probably null
R6043:Kitl UTSW 10 100064085 missense probably damaging 1.00
R6067:Kitl UTSW 10 100076906 critical splice donor site probably null
R6138:Kitl UTSW 10 100076906 critical splice donor site probably null
R6255:Kitl UTSW 10 100089233 makesense probably null
R6450:Kitl UTSW 10 100087394 start codon destroyed probably null 0.00
R6588:Kitl UTSW 10 100064092 missense probably damaging 1.00
R6951:Kitl UTSW 10 100051852 missense probably damaging 1.00
R7315:Kitl UTSW 10 100016112 missense unknown
R7368:Kitl UTSW 10 100016081 missense probably benign 0.02
R8010:Kitl UTSW 10 100051903 missense probably benign 0.22
R8234:Kitl UTSW 10 100051846 missense probably damaging 1.00
R9613:Kitl UTSW 10 100080919 missense probably damaging 1.00
U15987:Kitl UTSW 10 100076906 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAAATTGACCTGATACCATCG -3'
(R):5'- AGTTCATCCAGCAGGGGAAG -3'

Sequencing Primer
(F):5'- CTGTTGGCTTGCAGAGTTCAAATACC -3'
(R):5'- CAGGGGAAGCTTATAAAAGTTCAATC -3'
Posted On 2016-12-20