Incidental Mutation 'R5832:Galr2'
ID449371
Institutional Source Beutler Lab
Gene Symbol Galr2
Ensembl Gene ENSMUSG00000020793
Gene Namegalanin receptor 2
SynonymsmGalR, GalR2
MMRRC Submission 044054-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5832 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116280939-116283938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116281631 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 49 (L49Q)
Ref Sequence ENSEMBL: ENSMUSP00000054062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055872]
Predicted Effect probably damaging
Transcript: ENSMUST00000055872
AA Change: L49Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054062
Gene: ENSMUSG00000020793
AA Change: L49Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 306 4.1e-12 PFAM
Pfam:7tm_1 41 291 6.4e-52 PFAM
Pfam:7TM_GPCR_Srv 62 307 1.2e-7 PFAM
Pfam:7TM_GPCR_Srw 184 308 4.7e-8 PFAM
low complexity region 347 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154277
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Galanin is an important neuromodulator present in the brain, gastrointestinal system, and hypothalamopituitary axis. It is a 30-amino acid non-C-terminally amidated peptide that potently stimulates growth hormone secretion, inhibits cardiac vagal slowing of heart rate, abolishes sinus arrhythmia, and inhibits postprandial gastrointestinal motility. The actions of galanin are mediated through interaction with specific membrane receptors that are members of the 7-transmembrane family of G protein-coupled receptors. GALR2 interacts with the N-terminal residues of the galanin peptide. The primary signaling mechanism for GALR2 is through the phospholipase C/protein kinase C pathway (via Gq), in contrast to GALR1, which communicates its intracellular signal by inhibition of adenylyl cyclase through Gi. However, it has been demonstrated that GALR2 couples efficiently to both the Gq and Gi proteins to simultaneously activate 2 independent signal transduction pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a reduction in exploratory activity. There is also a modest shift in the distribution of different lymphocyte cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adgrv1 G A 13: 81,103,302 S6232F possibly damaging Het
Alox12 T C 11: 70,253,280 E129G probably damaging Het
Anxa13 C A 15: 58,341,993 noncoding transcript Het
Arfgef3 C T 10: 18,630,420 G878D probably damaging Het
Asnsd1 T C 1: 53,347,475 D331G probably damaging Het
Crisp1 A G 17: 40,301,317 probably null Het
Eml5 T C 12: 98,876,188 N217S probably benign Het
Fat1 A T 8: 45,017,423 Y1463F possibly damaging Het
Fhod3 T C 18: 25,090,695 W1033R probably damaging Het
Gstm5 T C 3: 107,897,537 V115A probably benign Het
Gtpbp2 C T 17: 46,167,862 T535I probably damaging Het
Hk1 T C 10: 62,292,365 E326G probably benign Het
Igfn1 A G 1: 135,974,795 V388A probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kitl C A 10: 100,080,020 P137H probably damaging Het
Lamp3 A T 16: 19,701,320 Y38N probably damaging Het
Lmo7 A T 14: 101,884,213 N5I probably damaging Het
Mc3r T A 2: 172,249,430 C191S probably benign Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mybpc3 A G 2: 91,119,175 probably null Het
Nav2 A T 7: 49,548,069 probably null Het
Patz1 C T 11: 3,306,277 P521L probably benign Het
Pramef17 A G 4: 143,991,962 S304P probably damaging Het
Prkcd T C 14: 30,605,821 T103A probably damaging Het
Pttg1ip T C 10: 77,584,025 probably null Het
Rcbtb2 C A 14: 73,166,822 Q85K possibly damaging Het
Rdh16f1 T A 10: 127,788,749 V152E probably damaging Het
Rsph4a A G 10: 33,909,502 I470V probably benign Het
Sarnp T C 10: 128,848,312 probably null Het
Slc39a6 C A 18: 24,601,612 V7L possibly damaging Het
Slco1a4 A G 6: 141,819,544 I324T probably benign Het
Spata31d1a A T 13: 59,701,566 V916E probably damaging Het
Srgap1 T G 10: 121,840,914 T392P probably damaging Het
Tbc1d20 A T 2: 152,311,362 M271L possibly damaging Het
Tbc1d22b T C 17: 29,570,647 I161T possibly damaging Het
Tcof1 G T 18: 60,819,539 N918K unknown Het
Tnr A G 1: 159,886,122 T707A probably benign Het
Trim66 A G 7: 109,455,202 F1267S probably damaging Het
Trpm6 A G 19: 18,786,819 H263R possibly damaging Het
Tshz2 T A 2: 169,884,045 V187D possibly damaging Het
Ube2f T G 1: 91,285,324 V176G possibly damaging Het
Vmn2r109 C T 17: 20,541,056 A680T probably benign Het
Vmn2r77 T A 7: 86,811,462 C665* probably null Het
Zfp954 A G 7: 7,115,390 V385A probably damaging Het
Other mutations in Galr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Galr2 APN 11 116283170 missense probably damaging 1.00
PIT4418001:Galr2 UTSW 11 116283258 missense probably benign 0.35
PIT4445001:Galr2 UTSW 11 116281648 missense probably benign 0.13
R0426:Galr2 UTSW 11 116281691 missense probably damaging 1.00
R1869:Galr2 UTSW 11 116283243 missense possibly damaging 0.87
R2059:Galr2 UTSW 11 116282939 missense probably damaging 1.00
R4579:Galr2 UTSW 11 116281499 missense probably benign
R4666:Galr2 UTSW 11 116283629 missense probably benign
R5974:Galr2 UTSW 11 116283026 missense possibly damaging 0.62
R7081:Galr2 UTSW 11 116283048 missense probably damaging 0.99
R7155:Galr2 UTSW 11 116283582 missense possibly damaging 0.94
R7696:Galr2 UTSW 11 116283167 missense probably damaging 1.00
R7810:Galr2 UTSW 11 116283120 missense probably benign 0.23
X0009:Galr2 UTSW 11 116283323 missense probably benign 0.14
X0026:Galr2 UTSW 11 116281751 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGAGCTCGACAGTCTTGC -3'
(R):5'- GAATGTTCACTCACCTGTCCAGC -3'

Sequencing Primer
(F):5'- GCTACGCGCTCACCAAG -3'
(R):5'- TCACCTGTCCAGCGAGACAG -3'
Posted On2016-12-20