Incidental Mutation 'R5832:Eml5'
ID 449373
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
MMRRC Submission 044054-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R5832 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 98786805-98901484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98876188 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 217 (N217S)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably benign
Transcript: ENSMUST00000065716
AA Change: N217S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: N217S

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223282
AA Change: N217S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adgrv1 G A 13: 81,103,302 S6232F possibly damaging Het
Alox12 T C 11: 70,253,280 E129G probably damaging Het
Anxa13 C A 15: 58,341,993 noncoding transcript Het
Arfgef3 C T 10: 18,630,420 G878D probably damaging Het
Asnsd1 T C 1: 53,347,475 D331G probably damaging Het
Crisp1 A G 17: 40,301,317 probably null Het
Fat1 A T 8: 45,017,423 Y1463F possibly damaging Het
Fhod3 T C 18: 25,090,695 W1033R probably damaging Het
Galr2 T A 11: 116,281,631 L49Q probably damaging Het
Gstm5 T C 3: 107,897,537 V115A probably benign Het
Gtpbp2 C T 17: 46,167,862 T535I probably damaging Het
Hk1 T C 10: 62,292,365 E326G probably benign Het
Igfn1 A G 1: 135,974,795 V388A probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kitl C A 10: 100,080,020 P137H probably damaging Het
Lamp3 A T 16: 19,701,320 Y38N probably damaging Het
Lmo7 A T 14: 101,884,213 N5I probably damaging Het
Mc3r T A 2: 172,249,430 C191S probably benign Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mybpc3 A G 2: 91,119,175 probably null Het
Nav2 A T 7: 49,548,069 probably null Het
Patz1 C T 11: 3,306,277 P521L probably benign Het
Pramef17 A G 4: 143,991,962 S304P probably damaging Het
Prkcd T C 14: 30,605,821 T103A probably damaging Het
Pttg1ip T C 10: 77,584,025 probably null Het
Rcbtb2 C A 14: 73,166,822 Q85K possibly damaging Het
Rdh16f1 T A 10: 127,788,749 V152E probably damaging Het
Rsph4a A G 10: 33,909,502 I470V probably benign Het
Sarnp T C 10: 128,848,312 probably null Het
Slc39a6 C A 18: 24,601,612 V7L possibly damaging Het
Slco1a4 A G 6: 141,819,544 I324T probably benign Het
Spata31d1a A T 13: 59,701,566 V916E probably damaging Het
Srgap1 T G 10: 121,840,914 T392P probably damaging Het
Tbc1d20 A T 2: 152,311,362 M271L possibly damaging Het
Tbc1d22b T C 17: 29,570,647 I161T possibly damaging Het
Tcof1 G T 18: 60,819,539 N918K unknown Het
Tnr A G 1: 159,886,122 T707A probably benign Het
Trim66 A G 7: 109,455,202 F1267S probably damaging Het
Trpm6 A G 19: 18,786,819 H263R possibly damaging Het
Tshz2 T A 2: 169,884,045 V187D possibly damaging Het
Ube2f T G 1: 91,285,324 V176G possibly damaging Het
Vmn2r109 C T 17: 20,541,056 A680T probably benign Het
Vmn2r77 T A 7: 86,811,462 C665* probably null Het
Zfp954 A G 7: 7,115,390 V385A probably damaging Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
BB010:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
R7353:Eml5 UTSW 12 98825424 missense
R7644:Eml5 UTSW 12 98855944 missense probably benign 0.05
R7694:Eml5 UTSW 12 98792563 missense probably damaging 0.99
R7842:Eml5 UTSW 12 98794135 missense probably damaging 1.00
R7933:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98792514 critical splice donor site probably null
R8198:Eml5 UTSW 12 98858886 nonsense probably null
R8482:Eml5 UTSW 12 98876301 missense probably damaging 1.00
R8732:Eml5 UTSW 12 98815959 missense probably damaging 0.99
R8956:Eml5 UTSW 12 98852693 missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98810570 missense probably damaging 0.99
R9131:Eml5 UTSW 12 98858840 missense probably damaging 1.00
R9258:Eml5 UTSW 12 98844117 missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98856028 missense probably damaging 0.99
R9276:Eml5 UTSW 12 98798801 missense probably damaging 0.99
R9301:Eml5 UTSW 12 98882033 nonsense probably null
R9368:Eml5 UTSW 12 98796578 missense probably benign 0.31
R9392:Eml5 UTSW 12 98900940 missense probably damaging 1.00
R9393:Eml5 UTSW 12 98876174 missense probably benign 0.35
R9449:Eml5 UTSW 12 98861295 missense probably damaging 1.00
R9570:Eml5 UTSW 12 98815984 missense probably benign 0.15
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTAATCTAGAAACTCTATGGC -3'
(R):5'- TAGGCAATTTCTAGCCTGCTAC -3'

Sequencing Primer
(F):5'- TCTGCACTATTCTGAAAAATACACTG -3'
(R):5'- AGGCAATTTCTAGCCTGCTACCATAG -3'
Posted On 2016-12-20