Mutagenetix > Incidental Mutations

Incidental Mutation 'R5832:Eml5'

449373

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

044054-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.339) question?

Stock #

R5832 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98876188 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 217 (N217S)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

Predicted Effect

probably benign
Transcript: ENSMUST00000065716
AA Change: N217S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: N217S

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223282
AA Change: N217S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 96.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Adgrv1	G	A	13: 81,103,302	S6232F	possibly damaging	Het
Alox12	T	C	11: 70,253,280	E129G	probably damaging	Het
Anxa13	C	A	15: 58,341,993		noncoding transcript	Het
Arfgef3	C	T	10: 18,630,420	G878D	probably damaging	Het
Asnsd1	T	C	1: 53,347,475	D331G	probably damaging	Het
Crisp1	A	G	17: 40,301,317		probably null	Het
Fat1	A	T	8: 45,017,423	Y1463F	possibly damaging	Het
Fhod3	T	C	18: 25,090,695	W1033R	probably damaging	Het
Galr2	T	A	11: 116,281,631	L49Q	probably damaging	Het
Gstm5	T	C	3: 107,897,537	V115A	probably benign	Het
Gtpbp2	C	T	17: 46,167,862	T535I	probably damaging	Het
Hk1	T	C	10: 62,292,365	E326G	probably benign	Het
Igfn1	A	G	1: 135,974,795	V388A	probably damaging	Het
Iqgap2	C	T	13: 95,675,372	R707H	probably damaging	Het
Kitl	C	A	10: 100,080,020	P137H	probably damaging	Het
Lamp3	A	T	16: 19,701,320	Y38N	probably damaging	Het
Lmo7	A	T	14: 101,884,213	N5I	probably damaging	Het
Mc3r	T	A	2: 172,249,430	C191S	probably benign	Het
Mep1a	G	A	17: 43,478,164	H574Y	probably benign	Het
Mybpc3	A	G	2: 91,119,175		probably null	Het
Nav2	A	T	7: 49,548,069		probably null	Het
Patz1	C	T	11: 3,306,277	P521L	probably benign	Het
Pramef17	A	G	4: 143,991,962	S304P	probably damaging	Het
Prkcd	T	C	14: 30,605,821	T103A	probably damaging	Het
Pttg1ip	T	C	10: 77,584,025		probably null	Het
Rcbtb2	C	A	14: 73,166,822	Q85K	possibly damaging	Het
Rdh16f1	T	A	10: 127,788,749	V152E	probably damaging	Het
Rsph4a	A	G	10: 33,909,502	I470V	probably benign	Het
Sarnp	T	C	10: 128,848,312		probably null	Het
Slc39a6	C	A	18: 24,601,612	V7L	possibly damaging	Het
Slco1a4	A	G	6: 141,819,544	I324T	probably benign	Het
Spata31d1a	A	T	13: 59,701,566	V916E	probably damaging	Het
Srgap1	T	G	10: 121,840,914	T392P	probably damaging	Het
Tbc1d20	A	T	2: 152,311,362	M271L	possibly damaging	Het
Tbc1d22b	T	C	17: 29,570,647	I161T	possibly damaging	Het
Tcof1	G	T	18: 60,819,539	N918K	unknown	Het
Tnr	A	G	1: 159,886,122	T707A	probably benign	Het
Trim66	A	G	7: 109,455,202	F1267S	probably damaging	Het
Trpm6	A	G	19: 18,786,819	H263R	possibly damaging	Het
Tshz2	T	A	2: 169,884,045	V187D	possibly damaging	Het
Ube2f	T	G	1: 91,285,324	V176G	possibly damaging	Het
Vmn2r109	C	T	17: 20,541,056	A680T	probably benign	Het
Vmn2r77	T	A	7: 86,811,462	C665*	probably null	Het
Zfp954	A	G	7: 7,115,390	V385A	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGCTAATCTAGAAACTCTATGGC -3'
(R):5'- TAGGCAATTTCTAGCCTGCTAC -3'

Sequencing Primer
(F):5'- TCTGCACTATTCTGAAAAATACACTG -3'
(R):5'- AGGCAATTTCTAGCCTGCTACCATAG -3'

Posted On

2016-12-20