Incidental Mutation 'R5832:Rcbtb2'
ID449378
Institutional Source Beutler Lab
Gene Symbol Rcbtb2
Ensembl Gene ENSMUSG00000022106
Gene Nameregulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2
SynonymsRc/btb2, Chc1l, 2610028E02Rik, 2810420M18Rik
MMRRC Submission 044054-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5832 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location73123037-73207843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73166822 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 85 (Q85K)
Ref Sequence ENSEMBL: ENSMUSP00000128479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022702] [ENSMUST00000110952] [ENSMUST00000163339] [ENSMUST00000163533] [ENSMUST00000163797] [ENSMUST00000164298] [ENSMUST00000164822] [ENSMUST00000165429] [ENSMUST00000165567] [ENSMUST00000165727] [ENSMUST00000167021] [ENSMUST00000167401] [ENSMUST00000169479] [ENSMUST00000169513] [ENSMUST00000170368] [ENSMUST00000170370] [ENSMUST00000170677] [ENSMUST00000171070] [ENSMUST00000171767]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022702
AA Change: Q245K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022702
Gene: ENSMUSG00000022106
AA Change: Q245K

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110952
AA Change: Q245K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106577
Gene: ENSMUSG00000022106
AA Change: Q245K

DomainStartEndE-ValueType
Pfam:RCC1 117 167 3e-16 PFAM
Pfam:RCC1_2 154 183 7.8e-15 PFAM
Pfam:RCC1 170 220 1.4e-15 PFAM
Pfam:RCC1 223 272 9.4e-18 PFAM
Pfam:RCC1_2 259 288 2.6e-11 PFAM
Pfam:RCC1 275 324 1.2e-13 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163339
Predicted Effect probably benign
Transcript: ENSMUST00000163533
SMART Domains Protein: ENSMUSP00000130828
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 117 150 4.3e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163797
AA Change: Q158K

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132125
Gene: ENSMUSG00000022106
AA Change: Q158K

DomainStartEndE-ValueType
Pfam:RCC1 136 174 7.7e-12 PFAM
low complexity region 199 207 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164298
AA Change: Q231K

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126651
Gene: ENSMUSG00000022106
AA Change: Q231K

DomainStartEndE-ValueType
Pfam:RCC1 103 153 2.9e-17 PFAM
Pfam:RCC1_2 140 169 2.2e-15 PFAM
Pfam:RCC1 156 206 4.4e-15 PFAM
Pfam:RCC1 209 247 1.2e-11 PFAM
low complexity region 272 280 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164822
AA Change: Q245K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131588
Gene: ENSMUSG00000022106
AA Change: Q245K

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165429
SMART Domains Protein: ENSMUSP00000127258
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 93 143 4.4e-17 PFAM
Pfam:RCC1_2 130 157 5.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165567
SMART Domains Protein: ENSMUSP00000130240
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 117 167 5.3e-17 PFAM
Pfam:RCC1_2 154 172 6.7e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165727
AA Change: Q85K

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128479
Gene: ENSMUSG00000022106
AA Change: Q85K

DomainStartEndE-ValueType
Pfam:RCC1 11 60 2.3e-14 PFAM
Pfam:RCC1 63 90 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167021
Predicted Effect probably benign
Transcript: ENSMUST00000167401
Predicted Effect possibly damaging
Transcript: ENSMUST00000169479
AA Change: Q245K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126898
Gene: ENSMUSG00000022106
AA Change: Q245K

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169513
AA Change: Q221K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128579
Gene: ENSMUSG00000022106
AA Change: Q221K

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170368
SMART Domains Protein: ENSMUSP00000126276
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
SCOP:d1a12a_ 45 86 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170370
SMART Domains Protein: ENSMUSP00000130732
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
SCOP:d1a12a_ 45 128 1e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170677
AA Change: Q221K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126510
Gene: ENSMUSG00000022106
AA Change: Q221K

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171163
Predicted Effect probably benign
Transcript: ENSMUST00000171767
AA Change: Q245K

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127397
Gene: ENSMUSG00000022106
AA Change: Q245K

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.7e-16 PFAM
Pfam:RCC1_2 154 183 4.9e-15 PFAM
Pfam:RCC1 170 220 8.4e-16 PFAM
Pfam:RCC1 223 272 5.5e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-11 PFAM
Pfam:RCC1 275 324 6.8e-14 PFAM
BTB 394 487 2.69e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two C-terminal BTB/POZ domains that is related to regulator of chromosome condensation (RCC). The encoded protein may act as a guanine nucleotide exchange factor. This gene is observed to be lost or underexpressed in prostate cancers. There is a pseudogene of this gene on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adgrv1 G A 13: 81,103,302 S6232F possibly damaging Het
Alox12 T C 11: 70,253,280 E129G probably damaging Het
Anxa13 C A 15: 58,341,993 noncoding transcript Het
Arfgef3 C T 10: 18,630,420 G878D probably damaging Het
Asnsd1 T C 1: 53,347,475 D331G probably damaging Het
Crisp1 A G 17: 40,301,317 probably null Het
Eml5 T C 12: 98,876,188 N217S probably benign Het
Fat1 A T 8: 45,017,423 Y1463F possibly damaging Het
Fhod3 T C 18: 25,090,695 W1033R probably damaging Het
Galr2 T A 11: 116,281,631 L49Q probably damaging Het
Gstm5 T C 3: 107,897,537 V115A probably benign Het
Gtpbp2 C T 17: 46,167,862 T535I probably damaging Het
Hk1 T C 10: 62,292,365 E326G probably benign Het
Igfn1 A G 1: 135,974,795 V388A probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kitl C A 10: 100,080,020 P137H probably damaging Het
Lamp3 A T 16: 19,701,320 Y38N probably damaging Het
Lmo7 A T 14: 101,884,213 N5I probably damaging Het
Mc3r T A 2: 172,249,430 C191S probably benign Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mybpc3 A G 2: 91,119,175 probably null Het
Nav2 A T 7: 49,548,069 probably null Het
Patz1 C T 11: 3,306,277 P521L probably benign Het
Pramef17 A G 4: 143,991,962 S304P probably damaging Het
Prkcd T C 14: 30,605,821 T103A probably damaging Het
Pttg1ip T C 10: 77,584,025 probably null Het
Rdh16f1 T A 10: 127,788,749 V152E probably damaging Het
Rsph4a A G 10: 33,909,502 I470V probably benign Het
Sarnp T C 10: 128,848,312 probably null Het
Slc39a6 C A 18: 24,601,612 V7L possibly damaging Het
Slco1a4 A G 6: 141,819,544 I324T probably benign Het
Spata31d1a A T 13: 59,701,566 V916E probably damaging Het
Srgap1 T G 10: 121,840,914 T392P probably damaging Het
Tbc1d20 A T 2: 152,311,362 M271L possibly damaging Het
Tbc1d22b T C 17: 29,570,647 I161T possibly damaging Het
Tcof1 G T 18: 60,819,539 N918K unknown Het
Tnr A G 1: 159,886,122 T707A probably benign Het
Trim66 A G 7: 109,455,202 F1267S probably damaging Het
Trpm6 A G 19: 18,786,819 H263R possibly damaging Het
Tshz2 T A 2: 169,884,045 V187D possibly damaging Het
Ube2f T G 1: 91,285,324 V176G possibly damaging Het
Vmn2r109 C T 17: 20,541,056 A680T probably benign Het
Vmn2r77 T A 7: 86,811,462 C665* probably null Het
Zfp954 A G 7: 7,115,390 V385A probably damaging Het
Other mutations in Rcbtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Rcbtb2 APN 14 73164782 missense possibly damaging 0.94
IGL02550:Rcbtb2 APN 14 73162019 missense probably damaging 1.00
IGL02800:Rcbtb2 APN 14 73168103 nonsense probably null
IGL02811:Rcbtb2 APN 14 73174411 missense probably damaging 1.00
R0319:Rcbtb2 UTSW 14 73178469 missense probably benign 0.04
R0390:Rcbtb2 UTSW 14 73178547 missense probably damaging 0.96
R0448:Rcbtb2 UTSW 14 73178429 splice site probably benign
R1298:Rcbtb2 UTSW 14 73162388 missense probably damaging 0.99
R1567:Rcbtb2 UTSW 14 73162462 missense probably benign 0.07
R2014:Rcbtb2 UTSW 14 73174386 splice site probably benign
R2137:Rcbtb2 UTSW 14 73162051 missense probably damaging 1.00
R2218:Rcbtb2 UTSW 14 73178565 critical splice donor site probably null
R4505:Rcbtb2 UTSW 14 73173905 missense probably damaging 1.00
R5898:Rcbtb2 UTSW 14 73161965 nonsense probably null
R6484:Rcbtb2 UTSW 14 73177050 missense probably damaging 0.99
R7252:Rcbtb2 UTSW 14 73166780 missense probably damaging 1.00
R7654:Rcbtb2 UTSW 14 73174501 missense probably benign 0.00
R7762:Rcbtb2 UTSW 14 73178466 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGCATGTGGGCAGATGTG -3'
(R):5'- CTGCACCTTAGTTCAGGGGAAG -3'

Sequencing Primer
(F):5'- CTCCATGGCTGTTGTGGACAC -3'
(R):5'- ACCTTAGTTCAGGGGAAGGCTTTG -3'
Posted On2016-12-20