Mutagenetix > Incidental Mutations

Incidental Mutation 'R5832:Lmo7'

449379

Institutional Source

Beutler Lab

Gene Symbol

Lmo7

Ensembl Gene

ENSMUSG00000033060

Gene Name

LIM domain only 7

Synonyms

FBXO20, LOC380928

MMRRC Submission

044054-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.177) question?

Stock #

R5832 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101729957-101934710 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101884213 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 5 (N5I)

Ref Sequence

ENSEMBL: ENSMUSP00000124349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159026] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100337
AA Change: N238I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: N238I

Domain	Start	End	E-Value	Type
CH	14	124	2.57e-13	SMART
low complexity region	200	211	N/A	INTRINSIC
Pfam:DUF4757	242	348	2.2e-14	PFAM
low complexity region	448	462	N/A	INTRINSIC
Pfam:DUF4757	568	735	1.8e-46	PFAM
low complexity region	861	879	N/A	INTRINSIC
low complexity region	979	991	N/A	INTRINSIC
low complexity region	1003	1015	N/A	INTRINSIC
PDZ	1047	1119	1.05e-8	SMART
coiled coil region	1222	1275	N/A	INTRINSIC
coiled coil region	1319	1411	N/A	INTRINSIC
low complexity region	1585	1596	N/A	INTRINSIC
low complexity region	1599	1617	N/A	INTRINSIC
LIM	1629	1687	6.54e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159026
AA Change: N5I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124605
Gene: ENSMUSG00000033060
AA Change: N5I

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC
coiled coil region	435	471	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159258
AA Change: N5I

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060
AA Change: N5I

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159314
AA Change: N5I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060
AA Change: N5I

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC
coiled coil region	435	492	N/A	INTRINSIC
low complexity region	628	646	N/A	INTRINSIC
low complexity region	746	758	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
PDZ	814	886	1.05e-8	SMART
coiled coil region	989	1042	N/A	INTRINSIC
coiled coil region	1086	1178	N/A	INTRINSIC
low complexity region	1352	1363	N/A	INTRINSIC
low complexity region	1366	1384	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159597
AA Change: N116I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: N116I

Domain	Start	End	E-Value	Type
low complexity region	78	89	N/A	INTRINSIC
internal_repeat_1	111	141	6.96e-5	PROSPERO
internal_repeat_1	218	248	6.96e-5	PROSPERO
low complexity region	326	340	N/A	INTRINSIC
coiled coil region	546	603	N/A	INTRINSIC
low complexity region	739	757	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	881	893	N/A	INTRINSIC
PDZ	925	997	1.05e-8	SMART
coiled coil region	1127	1180	N/A	INTRINSIC
coiled coil region	1224	1316	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1504	1522	N/A	INTRINSIC
LIM	1534	1592	6.54e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159769

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159797

Predicted Effect

unknown
Transcript: ENSMUST00000159806
AA Change: N71I

SMART Domains

Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060
AA Change: N71I

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
Pfam:DUF4757	76	225	4.5e-53	PFAM
low complexity region	351	369	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	493	505	N/A	INTRINSIC
PDZ	537	609	1.05e-8	SMART
internal_repeat_1	620	691	9.31e-5	PROSPERO
coiled coil region	711	764	N/A	INTRINSIC
coiled coil region	808	900	N/A	INTRINSIC
internal_repeat_1	921	976	9.31e-5	PROSPERO
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1089	1107	N/A	INTRINSIC
LIM	1119	1177	6.54e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159948

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161668

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162091

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Adgrv1	G	A	13: 81,103,302	S6232F	possibly damaging	Het
Alox12	T	C	11: 70,253,280	E129G	probably damaging	Het
Anxa13	C	A	15: 58,341,993		noncoding transcript	Het
Arfgef3	C	T	10: 18,630,420	G878D	probably damaging	Het
Asnsd1	T	C	1: 53,347,475	D331G	probably damaging	Het
Crisp1	A	G	17: 40,301,317		probably null	Het
Eml5	T	C	12: 98,876,188	N217S	probably benign	Het
Fat1	A	T	8: 45,017,423	Y1463F	possibly damaging	Het
Fhod3	T	C	18: 25,090,695	W1033R	probably damaging	Het
Galr2	T	A	11: 116,281,631	L49Q	probably damaging	Het
Gstm5	T	C	3: 107,897,537	V115A	probably benign	Het
Gtpbp2	C	T	17: 46,167,862	T535I	probably damaging	Het
Hk1	T	C	10: 62,292,365	E326G	probably benign	Het
Igfn1	A	G	1: 135,974,795	V388A	probably damaging	Het
Iqgap2	C	T	13: 95,675,372	R707H	probably damaging	Het
Kitl	C	A	10: 100,080,020	P137H	probably damaging	Het
Lamp3	A	T	16: 19,701,320	Y38N	probably damaging	Het
Mc3r	T	A	2: 172,249,430	C191S	probably benign	Het
Mep1a	G	A	17: 43,478,164	H574Y	probably benign	Het
Mybpc3	A	G	2: 91,119,175		probably null	Het
Nav2	A	T	7: 49,548,069		probably null	Het
Patz1	C	T	11: 3,306,277	P521L	probably benign	Het
Pramef17	A	G	4: 143,991,962	S304P	probably damaging	Het
Prkcd	T	C	14: 30,605,821	T103A	probably damaging	Het
Pttg1ip	T	C	10: 77,584,025		probably null	Het
Rcbtb2	C	A	14: 73,166,822	Q85K	possibly damaging	Het
Rdh16f1	T	A	10: 127,788,749	V152E	probably damaging	Het
Rsph4a	A	G	10: 33,909,502	I470V	probably benign	Het
Sarnp	T	C	10: 128,848,312		probably null	Het
Slc39a6	C	A	18: 24,601,612	V7L	possibly damaging	Het
Slco1a4	A	G	6: 141,819,544	I324T	probably benign	Het
Spata31d1a	A	T	13: 59,701,566	V916E	probably damaging	Het
Srgap1	T	G	10: 121,840,914	T392P	probably damaging	Het
Tbc1d20	A	T	2: 152,311,362	M271L	possibly damaging	Het
Tbc1d22b	T	C	17: 29,570,647	I161T	possibly damaging	Het
Tcof1	G	T	18: 60,819,539	N918K	unknown	Het
Tnr	A	G	1: 159,886,122	T707A	probably benign	Het
Trim66	A	G	7: 109,455,202	F1267S	probably damaging	Het
Trpm6	A	G	19: 18,786,819	H263R	possibly damaging	Het
Tshz2	T	A	2: 169,884,045	V187D	possibly damaging	Het
Ube2f	T	G	1: 91,285,324	V176G	possibly damaging	Het
Vmn2r109	C	T	17: 20,541,056	A680T	probably benign	Het
Vmn2r77	T	A	7: 86,811,462	C665*	probably null	Het
Zfp954	A	G	7: 7,115,390	V385A	probably damaging	Het

Other mutations in Lmo7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Lmo7	APN	14	101887051	missense	probably damaging	0.99
IGL00733:Lmo7	APN	14	101915702	missense	probably damaging	1.00
IGL00778:Lmo7	APN	14	101910885	splice site	probably benign
IGL01014:Lmo7	APN	14	101920557	splice site	probably benign
IGL01401:Lmo7	APN	14	101794277	nonsense	probably null
IGL01550:Lmo7	APN	14	101926140	utr 3 prime	probably benign
IGL01570:Lmo7	APN	14	101902371	critical splice donor site	probably null
IGL01602:Lmo7	APN	14	101910756	splice site	probably benign
IGL01605:Lmo7	APN	14	101910756	splice site	probably benign
IGL02012:Lmo7	APN	14	101888716	intron	probably benign
IGL02145:Lmo7	APN	14	101902223	missense	probably benign	0.00
IGL02236:Lmo7	APN	14	101926088	splice site	probably benign
IGL02318:Lmo7	APN	14	101900066	splice site	probably benign
IGL02345:Lmo7	APN	14	101887473	missense	probably damaging	1.00
IGL02498:Lmo7	APN	14	101807482	missense	probably benign	0.01
IGL02583:Lmo7	APN	14	101933924	utr 3 prime	probably benign
IGL02670:Lmo7	APN	14	101880980	missense	probably damaging	1.00
IGL02694:Lmo7	APN	14	101887170	missense	probably damaging	1.00
IGL03026:Lmo7	APN	14	101929333	utr 3 prime	probably benign
IGL03062:Lmo7	APN	14	101912079	missense	possibly damaging	0.66
IGL03068:Lmo7	APN	14	101875492	unclassified	probably benign
IGL03178:Lmo7	APN	14	101929260	nonsense	probably null
IGL03279:Lmo7	APN	14	101900508	missense	probably benign	0.30
PIT4458001:Lmo7	UTSW	14	101887487	nonsense	probably null
R0029:Lmo7	UTSW	14	101933921	utr 3 prime	probably benign
R0112:Lmo7	UTSW	14	101887193	nonsense	probably null
R0345:Lmo7	UTSW	14	101876877	missense	probably damaging	1.00
R0372:Lmo7	UTSW	14	101918053	splice site	probably benign
R0393:Lmo7	UTSW	14	101900456	missense	probably benign
R0514:Lmo7	UTSW	14	101887173	missense	probably damaging	1.00
R0514:Lmo7	UTSW	14	101896559	missense	probably damaging	1.00
R0526:Lmo7	UTSW	14	101900560	missense	probably damaging	1.00
R0615:Lmo7	UTSW	14	101876859	nonsense	probably null
R0900:Lmo7	UTSW	14	101887188	missense	probably damaging	1.00
R0961:Lmo7	UTSW	14	101794269	missense	probably benign	0.00
R0964:Lmo7	UTSW	14	101920567	splice site	probably benign
R1078:Lmo7	UTSW	14	101920474	splice site	probably benign
R1252:Lmo7	UTSW	14	101900583	missense	probably damaging	1.00
R1527:Lmo7	UTSW	14	101876828	missense	probably damaging	1.00
R1537:Lmo7	UTSW	14	101929264	utr 3 prime	probably benign
R1565:Lmo7	UTSW	14	101887521	missense	probably damaging	0.99
R1637:Lmo7	UTSW	14	101880832	missense	probably damaging	1.00
R1943:Lmo7	UTSW	14	101902302	missense	probably damaging	1.00
R1967:Lmo7	UTSW	14	101900215	missense	probably benign	0.36
R2002:Lmo7	UTSW	14	101887061	missense	probably benign	0.13
R2057:Lmo7	UTSW	14	101887178	missense	probably damaging	1.00
R2131:Lmo7	UTSW	14	101900238	missense	probably damaging	0.99
R2153:Lmo7	UTSW	14	101920515	utr 3 prime	probably benign
R2257:Lmo7	UTSW	14	101900130	missense	probably damaging	1.00
R2355:Lmo7	UTSW	14	101888685	missense	probably damaging	1.00
R2356:Lmo7	UTSW	14	101886945	missense	probably damaging	1.00
R2898:Lmo7	UTSW	14	101876914	missense	possibly damaging	0.93
R3847:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3848:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3849:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3916:Lmo7	UTSW	14	101929342	utr 3 prime	probably benign
R4050:Lmo7	UTSW	14	101902277	nonsense	probably null
R4326:Lmo7	UTSW	14	101900074	missense	possibly damaging	0.93
R4357:Lmo7	UTSW	14	101887655	missense	probably null	1.00
R4571:Lmo7	UTSW	14	101887594	missense	probably damaging	0.96
R4658:Lmo7	UTSW	14	101886957	missense	probably damaging	1.00
R4857:Lmo7	UTSW	14	101887348	splice site	probably null
R5006:Lmo7	UTSW	14	101926237	utr 3 prime	probably benign
R5528:Lmo7	UTSW	14	101902086	missense	probably damaging	1.00
R5588:Lmo7	UTSW	14	101896590	splice site	probably null
R5643:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5644:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5650:Lmo7	UTSW	14	101898674	missense	probably damaging	1.00
R5737:Lmo7	UTSW	14	101887236	missense	probably damaging	1.00
R5966:Lmo7	UTSW	14	101900502	missense	possibly damaging	0.92
R6026:Lmo7	UTSW	14	101880990	missense	probably benign	0.04
R6072:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R6158:Lmo7	UTSW	14	101900137	missense	probably benign	0.03
R6246:Lmo7	UTSW	14	101918700	missense	probably damaging	1.00
R6335:Lmo7	UTSW	14	101900636	missense	probably damaging	1.00
R6620:Lmo7	UTSW	14	101875452	missense	probably benign	0.29
R6658:Lmo7	UTSW	14	101910845	missense	possibly damaging	0.84
R6917:Lmo7	UTSW	14	101918010	missense	probably damaging	1.00
R7064:Lmo7	UTSW	14	101884179	missense	probably damaging	1.00
R7072:Lmo7	UTSW	14	101898700	critical splice donor site	probably null
R7121:Lmo7	UTSW	14	101887035	missense	probably damaging	1.00
R7136:Lmo7	UTSW	14	101920539	missense	unknown
R7196:Lmo7	UTSW	14	101896500	missense	possibly damaging	0.75
R7228:Lmo7	UTSW	14	101896535	missense	probably damaging	0.99
R7337:Lmo7	UTSW	14	101884204	missense	probably damaging	0.98
R7341:Lmo7	UTSW	14	101885512	missense	probably benign	0.30
R7408:Lmo7	UTSW	14	101880953	missense	probably damaging	1.00
R7432:Lmo7	UTSW	14	101902115	missense	probably benign	0.42
R7470:Lmo7	UTSW	14	101900604	missense	possibly damaging	0.83
R7506:Lmo7	UTSW	14	101919609	missense	unknown
R7559:Lmo7	UTSW	14	101887226	nonsense	probably null
R7565:Lmo7	UTSW	14	101885301	missense	probably damaging	0.98
R7788:Lmo7	UTSW	14	101898576	missense	possibly damaging	0.64
R8095:Lmo7	UTSW	14	101887419	missense	possibly damaging	0.88
R8100:Lmo7	UTSW	14	101900463	missense	probably benign	0.33
R8121:Lmo7	UTSW	14	101926300	missense	unknown
R8308:Lmo7	UTSW	14	101902371	critical splice donor site	probably null
R8371:Lmo7	UTSW	14	101887008	missense	possibly damaging	0.95
R8403:Lmo7	UTSW	14	101902364	missense	probably benign	0.03
X0066:Lmo7	UTSW	14	101887461	missense	probably damaging	1.00
X0067:Lmo7	UTSW	14	101886933	splice site	probably null
Z1176:Lmo7	UTSW	14	101884306	missense	probably damaging	0.99
Z1176:Lmo7	UTSW	14	101919281	missense	probably benign	0.00
Z1176:Lmo7	UTSW	14	101919443	missense	unknown
Z1176:Lmo7	UTSW	14	101929228	missense	unknown
Z1177:Lmo7	UTSW	14	101896518	missense	possibly damaging	0.96
Z1177:Lmo7	UTSW	14	101898557	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTCGTGGGTCTTATCACAAC -3'
(R):5'- CTACCTTGAAAATGTTCCGTCTG -3'

Sequencing Primer
(F):5'- GTGGGTCTTATCACAACTTCTTGAC -3'
(R):5'- CCGTCTGTTTCTGTGTAGACCG -3'

Posted On

2016-12-20