Mutagenetix > Incidental Mutations

Incidental Mutation 'R5832:Vmn2r109'

449381

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r109

Ensembl Gene

ENSMUSG00000090572

Gene Name

vomeronasal 2, receptor 109

Synonyms

EG627814

MMRRC Submission

044054-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R5832 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20540517-20564756 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20541056 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 680 (A680T)

Ref Sequence

ENSEMBL: ENSMUSP00000132641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167093]

Predicted Effect

probably benign
Transcript: ENSMUST00000167093
AA Change: A680T

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: A680T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	467	1.4e-35	PFAM
Pfam:NCD3G	510	563	3.1e-21	PFAM
Pfam:7tm_3	596	831	7.4e-52	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 96.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Adgrv1	G	A	13: 81,103,302	S6232F	possibly damaging	Het
Alox12	T	C	11: 70,253,280	E129G	probably damaging	Het
Anxa13	C	A	15: 58,341,993		noncoding transcript	Het
Arfgef3	C	T	10: 18,630,420	G878D	probably damaging	Het
Asnsd1	T	C	1: 53,347,475	D331G	probably damaging	Het
Crisp1	A	G	17: 40,301,317		probably null	Het
Eml5	T	C	12: 98,876,188	N217S	probably benign	Het
Fat1	A	T	8: 45,017,423	Y1463F	possibly damaging	Het
Fhod3	T	C	18: 25,090,695	W1033R	probably damaging	Het
Galr2	T	A	11: 116,281,631	L49Q	probably damaging	Het
Gstm5	T	C	3: 107,897,537	V115A	probably benign	Het
Gtpbp2	C	T	17: 46,167,862	T535I	probably damaging	Het
Hk1	T	C	10: 62,292,365	E326G	probably benign	Het
Igfn1	A	G	1: 135,974,795	V388A	probably damaging	Het
Iqgap2	C	T	13: 95,675,372	R707H	probably damaging	Het
Kitl	C	A	10: 100,080,020	P137H	probably damaging	Het
Lamp3	A	T	16: 19,701,320	Y38N	probably damaging	Het
Lmo7	A	T	14: 101,884,213	N5I	probably damaging	Het
Mc3r	T	A	2: 172,249,430	C191S	probably benign	Het
Mep1a	G	A	17: 43,478,164	H574Y	probably benign	Het
Mybpc3	A	G	2: 91,119,175		probably null	Het
Nav2	A	T	7: 49,548,069		probably null	Het
Patz1	C	T	11: 3,306,277	P521L	probably benign	Het
Pramef17	A	G	4: 143,991,962	S304P	probably damaging	Het
Prkcd	T	C	14: 30,605,821	T103A	probably damaging	Het
Pttg1ip	T	C	10: 77,584,025		probably null	Het
Rcbtb2	C	A	14: 73,166,822	Q85K	possibly damaging	Het
Rdh16f1	T	A	10: 127,788,749	V152E	probably damaging	Het
Rsph4a	A	G	10: 33,909,502	I470V	probably benign	Het
Sarnp	T	C	10: 128,848,312		probably null	Het
Slc39a6	C	A	18: 24,601,612	V7L	possibly damaging	Het
Slco1a4	A	G	6: 141,819,544	I324T	probably benign	Het
Spata31d1a	A	T	13: 59,701,566	V916E	probably damaging	Het
Srgap1	T	G	10: 121,840,914	T392P	probably damaging	Het
Tbc1d20	A	T	2: 152,311,362	M271L	possibly damaging	Het
Tbc1d22b	T	C	17: 29,570,647	I161T	possibly damaging	Het
Tcof1	G	T	18: 60,819,539	N918K	unknown	Het
Tnr	A	G	1: 159,886,122	T707A	probably benign	Het
Trim66	A	G	7: 109,455,202	F1267S	probably damaging	Het
Trpm6	A	G	19: 18,786,819	H263R	possibly damaging	Het
Tshz2	T	A	2: 169,884,045	V187D	possibly damaging	Het
Ube2f	T	G	1: 91,285,324	V176G	possibly damaging	Het
Vmn2r77	T	A	7: 86,811,462	C665*	probably null	Het
Zfp954	A	G	7: 7,115,390	V385A	probably damaging	Het

Other mutations in Vmn2r109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Vmn2r109	APN	17	20550157	missense	probably damaging	1.00
IGL01383:Vmn2r109	APN	17	20541121	missense	possibly damaging	0.89
IGL01469:Vmn2r109	APN	17	20541409	missense	probably damaging	1.00
IGL01762:Vmn2r109	APN	17	20554392	missense	probably benign
IGL01864:Vmn2r109	APN	17	20541134	missense	probably benign	0.28
IGL02028:Vmn2r109	APN	17	20541080	missense	probably benign	0.28
IGL02074:Vmn2r109	APN	17	20554341	missense	probably benign	0.05
IGL02162:Vmn2r109	APN	17	20554160	missense	probably benign	0.01
IGL02474:Vmn2r109	APN	17	20540888	missense	probably benign
IGL02490:Vmn2r109	APN	17	20540984	missense	possibly damaging	0.78
IGL02604:Vmn2r109	APN	17	20540701	missense	probably damaging	1.00
IGL02669:Vmn2r109	APN	17	20554256	missense	possibly damaging	0.64
IGL02705:Vmn2r109	APN	17	20553800	missense	probably benign
IGL02745:Vmn2r109	APN	17	20541250	missense	probably damaging	0.99
PIT4142001:Vmn2r109	UTSW	17	20554577	critical splice acceptor site	probably null
R0389:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R0470:Vmn2r109	UTSW	17	20552886	missense	probably benign	0.06
R0570:Vmn2r109	UTSW	17	20540675	missense	probably damaging	0.99
R0855:Vmn2r109	UTSW	17	20541408	nonsense	probably null
R0882:Vmn2r109	UTSW	17	20554580	splice site	probably benign
R1241:Vmn2r109	UTSW	17	20555241	missense	possibly damaging	0.86
R1587:Vmn2r109	UTSW	17	20540740	missense	probably damaging	1.00
R1931:Vmn2r109	UTSW	17	20553810	nonsense	probably null
R1957:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R1962:Vmn2r109	UTSW	17	20553923	missense	probably damaging	0.99
R2020:Vmn2r109	UTSW	17	20541186	nonsense	probably null
R2073:Vmn2r109	UTSW	17	20564712	missense	probably benign	0.00
R2436:Vmn2r109	UTSW	17	20554536	missense	probably damaging	0.99
R3123:Vmn2r109	UTSW	17	20540986	missense	probably damaging	1.00
R3839:Vmn2r109	UTSW	17	20554442	missense	probably damaging	1.00
R4019:Vmn2r109	UTSW	17	20553812	missense	probably benign
R4428:Vmn2r109	UTSW	17	20553024	missense	probably benign
R4584:Vmn2r109	UTSW	17	20554558	nonsense	probably null
R4652:Vmn2r109	UTSW	17	20541394	missense	probably damaging	1.00
R4708:Vmn2r109	UTSW	17	20541343	missense	probably damaging	0.97
R4823:Vmn2r109	UTSW	17	20553891	missense	probably damaging	1.00
R4831:Vmn2r109	UTSW	17	20541232	missense	probably benign	0.01
R4907:Vmn2r109	UTSW	17	20550086	missense	probably damaging	1.00
R5011:Vmn2r109	UTSW	17	20555189	missense	probably damaging	1.00
R5296:Vmn2r109	UTSW	17	20554341	missense	possibly damaging	0.90
R5600:Vmn2r109	UTSW	17	20540927	missense	probably damaging	1.00
R5602:Vmn2r109	UTSW	17	20540671	missense	possibly damaging	0.94
R5652:Vmn2r109	UTSW	17	20540519	makesense	probably null
R5702:Vmn2r109	UTSW	17	20554145	missense	probably benign	0.42
R5706:Vmn2r109	UTSW	17	20554305	missense	probably benign	0.16
R5714:Vmn2r109	UTSW	17	20552859	missense	probably damaging	1.00
R6008:Vmn2r109	UTSW	17	20540719	missense	probably damaging	1.00
R6334:Vmn2r109	UTSW	17	20541178	missense	probably benign	0.18
R6377:Vmn2r109	UTSW	17	20564534	critical splice donor site	probably null
R6738:Vmn2r109	UTSW	17	20554523	missense	possibly damaging	0.52
R6857:Vmn2r109	UTSW	17	20540670	missense	probably benign	0.45
R6953:Vmn2r109	UTSW	17	20540711	missense	possibly damaging	0.95
R7108:Vmn2r109	UTSW	17	20564744	missense	probably benign	0.03
R7229:Vmn2r109	UTSW	17	20540963	missense	possibly damaging	0.80
R7238:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R7244:Vmn2r109	UTSW	17	20540683	missense	possibly damaging	0.70
R7292:Vmn2r109	UTSW	17	20541438	missense	probably benign	0.05
R7354:Vmn2r109	UTSW	17	20540781	missense	probably damaging	1.00
R7357:Vmn2r109	UTSW	17	20541274	missense	probably damaging	1.00
R7522:Vmn2r109	UTSW	17	20554403	missense	probably benign	0.11
R7596:Vmn2r109	UTSW	17	20540680	missense	probably damaging	0.98
R7728:Vmn2r109	UTSW	17	20552855	missense	probably damaging	0.99
R7859:Vmn2r109	UTSW	17	20541174	missense	probably damaging	1.00
R7871:Vmn2r109	UTSW	17	20540520	missense	probably benign	0.08
R7942:Vmn2r109	UTSW	17	20541174	missense	probably damaging	1.00
R7954:Vmn2r109	UTSW	17	20540520	missense	probably benign	0.08
Z1176:Vmn2r109	UTSW	17	20552994	missense	not run

Predicted Primers

PCR Primer
(F):5'- GCAGAGGTATCCCAGAACACAG -3'
(R):5'- AGGTCTCAGTTACACTTTGCTC -3'

Sequencing Primer
(F):5'- AGGCAACAGATGATCCCTTGTTG -3'
(R):5'- AGTTACACTTTGCTCATCACAATCAC -3'

Posted On

2016-12-20