Incidental Mutation 'R5832:Tbc1d22b'
ID449382
Institutional Source Beutler Lab
Gene Symbol Tbc1d22b
Ensembl Gene ENSMUSG00000042203
Gene NameTBC1 domain family, member 22B
Synonyms
MMRRC Submission 044054-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R5832 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location29549788-29606895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29570647 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 161 (I161T)
Ref Sequence ENSEMBL: ENSMUSP00000046877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048677
AA Change: I161T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046877
Gene: ENSMUSG00000042203
AA Change: I161T

DomainStartEndE-ValueType
Blast:TBC 23 93 6e-12 BLAST
TBC 207 460 1.25e-56 SMART
Blast:TBC 464 504 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160114
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adgrv1 G A 13: 81,103,302 S6232F possibly damaging Het
Alox12 T C 11: 70,253,280 E129G probably damaging Het
Anxa13 C A 15: 58,341,993 noncoding transcript Het
Arfgef3 C T 10: 18,630,420 G878D probably damaging Het
Asnsd1 T C 1: 53,347,475 D331G probably damaging Het
Crisp1 A G 17: 40,301,317 probably null Het
Eml5 T C 12: 98,876,188 N217S probably benign Het
Fat1 A T 8: 45,017,423 Y1463F possibly damaging Het
Fhod3 T C 18: 25,090,695 W1033R probably damaging Het
Galr2 T A 11: 116,281,631 L49Q probably damaging Het
Gstm5 T C 3: 107,897,537 V115A probably benign Het
Gtpbp2 C T 17: 46,167,862 T535I probably damaging Het
Hk1 T C 10: 62,292,365 E326G probably benign Het
Igfn1 A G 1: 135,974,795 V388A probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kitl C A 10: 100,080,020 P137H probably damaging Het
Lamp3 A T 16: 19,701,320 Y38N probably damaging Het
Lmo7 A T 14: 101,884,213 N5I probably damaging Het
Mc3r T A 2: 172,249,430 C191S probably benign Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mybpc3 A G 2: 91,119,175 probably null Het
Nav2 A T 7: 49,548,069 probably null Het
Patz1 C T 11: 3,306,277 P521L probably benign Het
Pramef17 A G 4: 143,991,962 S304P probably damaging Het
Prkcd T C 14: 30,605,821 T103A probably damaging Het
Pttg1ip T C 10: 77,584,025 probably null Het
Rcbtb2 C A 14: 73,166,822 Q85K possibly damaging Het
Rdh16f1 T A 10: 127,788,749 V152E probably damaging Het
Rsph4a A G 10: 33,909,502 I470V probably benign Het
Sarnp T C 10: 128,848,312 probably null Het
Slc39a6 C A 18: 24,601,612 V7L possibly damaging Het
Slco1a4 A G 6: 141,819,544 I324T probably benign Het
Spata31d1a A T 13: 59,701,566 V916E probably damaging Het
Srgap1 T G 10: 121,840,914 T392P probably damaging Het
Tbc1d20 A T 2: 152,311,362 M271L possibly damaging Het
Tcof1 G T 18: 60,819,539 N918K unknown Het
Tnr A G 1: 159,886,122 T707A probably benign Het
Trim66 A G 7: 109,455,202 F1267S probably damaging Het
Trpm6 A G 19: 18,786,819 H263R possibly damaging Het
Tshz2 T A 2: 169,884,045 V187D possibly damaging Het
Ube2f T G 1: 91,285,324 V176G possibly damaging Het
Vmn2r109 C T 17: 20,541,056 A680T probably benign Het
Vmn2r77 T A 7: 86,811,462 C665* probably null Het
Zfp954 A G 7: 7,115,390 V385A probably damaging Het
Other mutations in Tbc1d22b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Tbc1d22b APN 17 29568598 missense possibly damaging 0.60
IGL01836:Tbc1d22b APN 17 29599958 missense probably damaging 1.00
R1524:Tbc1d22b UTSW 17 29570611 missense probably damaging 0.99
R1681:Tbc1d22b UTSW 17 29575177 missense possibly damaging 0.46
R1757:Tbc1d22b UTSW 17 29571673 missense probably damaging 1.00
R2268:Tbc1d22b UTSW 17 29599854 missense probably damaging 1.00
R5656:Tbc1d22b UTSW 17 29594780 missense probably damaging 1.00
R6892:Tbc1d22b UTSW 17 29595890 missense possibly damaging 0.80
R7095:Tbc1d22b UTSW 17 29599869 missense probably damaging 0.96
R7780:Tbc1d22b UTSW 17 29573066 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCATATGCAGTCCCTGTGTG -3'
(R):5'- TAGATGTGAGACCTCTGAGGG -3'

Sequencing Primer
(F):5'- GCAGGGCCTCATTCTCACTG -3'
(R):5'- ACCTCTGAGGGCCATAGTCAC -3'
Posted On2016-12-20