Incidental Mutation 'R5832:Fhod3'
ID449387
Institutional Source Beutler Lab
Gene Symbol Fhod3
Ensembl Gene ENSMUSG00000034295
Gene Nameformin homology 2 domain containing 3
SynonymsA930009H06Rik
MMRRC Submission 044054-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5832 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location24709445-25133500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25090695 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1033 (W1033R)
Ref Sequence ENSEMBL: ENSMUSP00000041361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037097]
Predicted Effect probably damaging
Transcript: ENSMUST00000037097
AA Change: W1033R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295
AA Change: W1033R

DomainStartEndE-ValueType
PDB:3DAD|B 1 327 1e-127 PDB
Blast:Drf_GBD 73 204 3e-60 BLAST
Blast:FH2 219 306 4e-25 BLAST
low complexity region 399 420 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 553 583 N/A INTRINSIC
coiled coil region 598 632 N/A INTRINSIC
low complexity region 674 701 N/A INTRINSIC
low complexity region 753 763 N/A INTRINSIC
low complexity region 784 793 N/A INTRINSIC
Blast:FH2 879 918 1e-9 BLAST
Blast:FH2 931 964 1e-7 BLAST
low complexity region 965 980 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
FH2 1039 1492 3.96e-72 SMART
Blast:FH2 1506 1570 9e-11 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the diaphanous-related formins (DRF), and contains multiple domains, including GBD (GTPase-binding domain), DID (diaphanous inhibitory domain), FH1 (formin homology 1), FH2 (formin homology 2), and DAD (diaphanous auto-regulatory domain) domains. This protein is thought to play a role in actin filament polymerization in cardiomyocytes. Mutations in this gene have been associated with dilated cardiomyopathy (DCM), characterized by dilation of the ventricular chamber, leading to impairment of systolic pump function and subsequent heart failure. Increased levels of the protein encoded by this gene have been observed in individuals with hypertrophic cardiomyopathy (HCM). Alternative splicing results in multiple transcript variants encoding different isoforms. A muscle-specific isoform has been shown to possess a casein kinase 2 (CK2) phosphorylation site at the C-terminal end of the FH2 domain. Phosphorylation of this site alters its interaction with sequestosome 1 (SQSTM1), and targets this isoform to myofibrils, while other isoforms form cytoplasmic aggregates. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out reporter allele exhibit abnormal premyofibril maturation, impaired heart development, pericardial effusion and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adgrv1 G A 13: 81,103,302 S6232F possibly damaging Het
Alox12 T C 11: 70,253,280 E129G probably damaging Het
Anxa13 C A 15: 58,341,993 noncoding transcript Het
Arfgef3 C T 10: 18,630,420 G878D probably damaging Het
Asnsd1 T C 1: 53,347,475 D331G probably damaging Het
Crisp1 A G 17: 40,301,317 probably null Het
Eml5 T C 12: 98,876,188 N217S probably benign Het
Fat1 A T 8: 45,017,423 Y1463F possibly damaging Het
Galr2 T A 11: 116,281,631 L49Q probably damaging Het
Gstm5 T C 3: 107,897,537 V115A probably benign Het
Gtpbp2 C T 17: 46,167,862 T535I probably damaging Het
Hk1 T C 10: 62,292,365 E326G probably benign Het
Igfn1 A G 1: 135,974,795 V388A probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kitl C A 10: 100,080,020 P137H probably damaging Het
Lamp3 A T 16: 19,701,320 Y38N probably damaging Het
Lmo7 A T 14: 101,884,213 N5I probably damaging Het
Mc3r T A 2: 172,249,430 C191S probably benign Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mybpc3 A G 2: 91,119,175 probably null Het
Nav2 A T 7: 49,548,069 probably null Het
Patz1 C T 11: 3,306,277 P521L probably benign Het
Pramef17 A G 4: 143,991,962 S304P probably damaging Het
Prkcd T C 14: 30,605,821 T103A probably damaging Het
Pttg1ip T C 10: 77,584,025 probably null Het
Rcbtb2 C A 14: 73,166,822 Q85K possibly damaging Het
Rdh16f1 T A 10: 127,788,749 V152E probably damaging Het
Rsph4a A G 10: 33,909,502 I470V probably benign Het
Sarnp T C 10: 128,848,312 probably null Het
Slc39a6 C A 18: 24,601,612 V7L possibly damaging Het
Slco1a4 A G 6: 141,819,544 I324T probably benign Het
Spata31d1a A T 13: 59,701,566 V916E probably damaging Het
Srgap1 T G 10: 121,840,914 T392P probably damaging Het
Tbc1d20 A T 2: 152,311,362 M271L possibly damaging Het
Tbc1d22b T C 17: 29,570,647 I161T possibly damaging Het
Tcof1 G T 18: 60,819,539 N918K unknown Het
Tnr A G 1: 159,886,122 T707A probably benign Het
Trim66 A G 7: 109,455,202 F1267S probably damaging Het
Trpm6 A G 19: 18,786,819 H263R possibly damaging Het
Tshz2 T A 2: 169,884,045 V187D possibly damaging Het
Ube2f T G 1: 91,285,324 V176G possibly damaging Het
Vmn2r109 C T 17: 20,541,056 A680T probably benign Het
Vmn2r77 T A 7: 86,811,462 C665* probably null Het
Zfp954 A G 7: 7,115,390 V385A probably damaging Het
Other mutations in Fhod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Fhod3 APN 18 24994540 missense probably damaging 1.00
IGL01139:Fhod3 APN 18 25066344 missense probably benign 0.00
IGL01293:Fhod3 APN 18 25020652 splice site probably benign
IGL01313:Fhod3 APN 18 25020720 missense probably damaging 1.00
IGL01524:Fhod3 APN 18 25130602 missense probably damaging 0.99
IGL01568:Fhod3 APN 18 25120162 missense probably benign 0.04
IGL01586:Fhod3 APN 18 25090747 missense probably damaging 0.98
IGL01622:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01623:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01640:Fhod3 APN 18 25115793 missense probably benign 0.13
IGL01860:Fhod3 APN 18 24897681 missense probably damaging 0.99
IGL01860:Fhod3 APN 18 24903948 missense probably damaging 1.00
IGL02192:Fhod3 APN 18 25056358 missense probably damaging 1.00
IGL02390:Fhod3 APN 18 25066275 missense probably benign 0.15
IGL02550:Fhod3 APN 18 25022960 missense probably benign 0.00
IGL02987:Fhod3 APN 18 25113553 missense possibly damaging 0.87
R0328:Fhod3 UTSW 18 25113600 missense probably benign 0.01
R0362:Fhod3 UTSW 18 25090076 nonsense probably null
R0373:Fhod3 UTSW 18 25090104 missense possibly damaging 0.93
R0483:Fhod3 UTSW 18 24709616 missense probably damaging 1.00
R0570:Fhod3 UTSW 18 25112583 missense probably benign 0.27
R0617:Fhod3 UTSW 18 25112679 splice site probably benign
R0834:Fhod3 UTSW 18 25115805 nonsense probably null
R0836:Fhod3 UTSW 18 25066218 missense probably damaging 1.00
R1132:Fhod3 UTSW 18 25020665 small deletion probably benign
R1157:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1158:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1160:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1381:Fhod3 UTSW 18 25090471 missense probably damaging 1.00
R1533:Fhod3 UTSW 18 25115864 missense probably damaging 1.00
R1621:Fhod3 UTSW 18 25022867 missense probably benign 0.35
R1748:Fhod3 UTSW 18 24770493 nonsense probably null
R1757:Fhod3 UTSW 18 25066278 missense possibly damaging 0.78
R1758:Fhod3 UTSW 18 25120310 missense possibly damaging 0.88
R1872:Fhod3 UTSW 18 25130610 missense probably damaging 1.00
R1911:Fhod3 UTSW 18 25112586 missense possibly damaging 0.81
R1917:Fhod3 UTSW 18 24989965 splice site probably benign
R1917:Fhod3 UTSW 18 25085601 missense probably benign 0.27
R1934:Fhod3 UTSW 18 25090278 missense probably benign 0.35
R1958:Fhod3 UTSW 18 25090465 missense probably damaging 1.00
R1997:Fhod3 UTSW 18 25090416 missense possibly damaging 0.79
R3618:Fhod3 UTSW 18 25020665 small deletion probably benign
R3709:Fhod3 UTSW 18 25090758 missense probably damaging 1.00
R3937:Fhod3 UTSW 18 25090761 missense probably benign 0.44
R4246:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4248:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4249:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4497:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4498:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4532:Fhod3 UTSW 18 25110221 missense probably damaging 1.00
R4596:Fhod3 UTSW 18 25115718 missense probably benign 0.01
R4628:Fhod3 UTSW 18 25120129 missense possibly damaging 0.94
R4667:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4668:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4734:Fhod3 UTSW 18 25028135 missense probably benign 0.00
R4753:Fhod3 UTSW 18 25090325 missense possibly damaging 0.80
R4796:Fhod3 UTSW 18 24985301 missense probably damaging 1.00
R4832:Fhod3 UTSW 18 25090248 missense probably benign 0.00
R5338:Fhod3 UTSW 18 25028081 missense probably damaging 0.96
R5863:Fhod3 UTSW 18 25125753 missense probably benign 0.25
R6362:Fhod3 UTSW 18 24754255 missense probably benign 0.00
R6414:Fhod3 UTSW 18 25090878 missense possibly damaging 0.64
R7099:Fhod3 UTSW 18 25090162 missense probably benign
R7172:Fhod3 UTSW 18 25085546 missense probably damaging 1.00
R7190:Fhod3 UTSW 18 25090755 missense probably damaging 1.00
R7241:Fhod3 UTSW 18 25060352 missense probably damaging 1.00
R7294:Fhod3 UTSW 18 25132980 missense probably damaging 1.00
R7348:Fhod3 UTSW 18 25090467 missense possibly damaging 0.80
R7432:Fhod3 UTSW 18 25001909 missense possibly damaging 0.95
R7588:Fhod3 UTSW 18 25090248 missense probably benign 0.02
R7629:Fhod3 UTSW 18 24754317 missense probably benign 0.08
R7667:Fhod3 UTSW 18 25001944 missense probably benign
R7681:Fhod3 UTSW 18 24990038 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTTCACAGACCTAGGGGAG -3'
(R):5'- TGGACTCAAACAGGTGCTC -3'

Sequencing Primer
(F):5'- AGGAGGACGATATCGATGTTTTG -3'
(R):5'- ACTCAAACAGGTGCTCGAGTCTG -3'
Posted On2016-12-20