Incidental Mutation 'R5833:Gm6309'
ID 449402
Institutional Source Beutler Lab
Gene Symbol Gm6309
Ensembl Gene ENSMUSG00000096798
Gene Name predicted gene 6309
Synonyms
MMRRC Submission 043221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R5833 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 146167976-146170721 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 146168318 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 262 (S262P)
Ref Sequence ENSEMBL: ENSMUSP00000134203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174320]
AlphaFold L7N481
Predicted Effect probably damaging
Transcript: ENSMUST00000174320
AA Change: S262P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134203
Gene: ENSMUSG00000096798
AA Change: S262P

DomainStartEndE-ValueType
RasGEFN 65 181 3.29e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 95.7%
  • 20x: 84.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 T C 5: 8,958,314 Y1161H probably damaging Het
Adcy2 T A 13: 68,738,603 M276L probably benign Het
Adi1 A G 12: 28,681,042 D166G probably benign Het
Arhgap44 T G 11: 65,038,677 E267A probably damaging Het
Arl11 T A 14: 61,311,062 L107Q probably damaging Het
C1qtnf3 A G 15: 10,975,630 D247G probably benign Het
C4b T C 17: 34,730,673 D1481G probably damaging Het
Cacna1a T C 8: 84,518,697 F242L probably damaging Het
Ccnl1 T C 3: 65,948,501 K298E probably benign Het
Dcaf5 A G 12: 80,348,429 V322A probably damaging Het
Ddr2 T C 1: 170,004,696 N175S probably benign Het
Enox1 T A 14: 77,506,939 M21K probably benign Het
Fhad1 T C 4: 142,002,527 D55G probably damaging Het
Gm5157 A G 7: 21,185,393 M75T possibly damaging Het
Gpnmb T C 6: 49,044,018 L82P probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Itpripl2 A C 7: 118,489,971 V455G probably benign Het
Kif16b A G 2: 142,707,367 V1087A probably benign Het
Med12l A G 3: 59,265,226 D1801G possibly damaging Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mtmr4 T A 11: 87,605,049 Y570* probably null Het
Osbpl1a G T 18: 12,788,362 N128K probably damaging Het
Pcdhb5 T A 18: 37,321,102 H178Q probably damaging Het
Pdlim1 A T 19: 40,230,545 F214Y probably damaging Het
Qk A T 17: 10,216,387 L236H probably damaging Het
Rexo2 G T 9: 48,468,871 D220E probably benign Het
Rras A G 7: 45,021,291 E195G possibly damaging Het
Serpinb11 T C 1: 107,377,662 probably null Het
Sp1 T A 15: 102,430,917 M430K possibly damaging Het
Tardbp A C 4: 148,617,660 V86G probably damaging Het
Trim43c A G 9: 88,843,037 Q203R possibly damaging Het
Vmn1r232 A G 17: 20,913,651 L229P probably damaging Het
Other mutations in Gm6309
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Gm6309 APN 5 146168411 missense probably benign 0.02
IGL01835:Gm6309 APN 5 146168275 missense probably damaging 0.99
FR4737:Gm6309 UTSW 5 146168183 missense probably benign
FR4976:Gm6309 UTSW 5 146168183 missense probably benign
R1513:Gm6309 UTSW 5 146170583 missense possibly damaging 0.83
R2022:Gm6309 UTSW 5 146168311 missense probably benign
R2191:Gm6309 UTSW 5 146168871 missense possibly damaging 0.93
R4735:Gm6309 UTSW 5 146168244 missense probably damaging 0.99
R5719:Gm6309 UTSW 5 146168182 missense probably benign 0.01
R5776:Gm6309 UTSW 5 146168881 missense possibly damaging 0.80
R6246:Gm6309 UTSW 5 146170240 missense probably damaging 1.00
R6373:Gm6309 UTSW 5 146170275 missense probably damaging 0.97
R6873:Gm6309 UTSW 5 146168188 missense probably damaging 0.96
R6912:Gm6309 UTSW 5 146168830 missense probably damaging 0.97
R6954:Gm6309 UTSW 5 146168490 missense possibly damaging 0.82
R7145:Gm6309 UTSW 5 146170290 missense possibly damaging 0.74
R7258:Gm6309 UTSW 5 146168296 missense probably benign 0.07
R7535:Gm6309 UTSW 5 146168290 missense probably damaging 1.00
R8885:Gm6309 UTSW 5 146168293 missense probably damaging 1.00
R8941:Gm6309 UTSW 5 146170345 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAACTCTGCAGACCATTCTCC -3'
(R):5'- TTAGATTTTGCCACAGCTCCAGAG -3'

Sequencing Primer
(F):5'- TCCTAACTATATGTCAACCTCAGG -3'
(R):5'- TCAGAGCAGGATGCCTCTG -3'
Posted On 2016-12-20