Incidental Mutation 'R0548:Marco'
ID44941
Institutional Source Beutler Lab
Gene Symbol Marco
Ensembl Gene ENSMUSG00000026390
Gene Namemacrophage receptor with collagenous structure
SynonymsScara2
MMRRC Submission 038740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0548 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location120474538-120505024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120492038 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 187 (T187A)
Ref Sequence ENSEMBL: ENSMUSP00000027639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027639] [ENSMUST00000186432]
PDB Structure
Crystal structure analysis of the monomeric SRCR domain of mouse MARCO [X-RAY DIFFRACTION]
Crystal structure analysis of the dimeric form of the SRCR domain of mouse MARCO [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027639
AA Change: T187A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027639
Gene: ENSMUSG00000026390
AA Change: T187A

DomainStartEndE-ValueType
SCOP:d1g38a_ 65 93 1e-2 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Collagen 149 208 2.5e-12 PFAM
Pfam:Collagen 192 266 2.7e-10 PFAM
low complexity region 293 315 N/A INTRINSIC
low complexity region 323 345 N/A INTRINSIC
internal_repeat_1 347 400 5.11e-17 PROSPERO
low complexity region 401 419 N/A INTRINSIC
SR 423 518 1.66e-48 SMART
Predicted Effect unknown
Transcript: ENSMUST00000186432
AA Change: T107A
SMART Domains Protein: ENSMUSP00000140948
Gene: ENSMUSG00000026390
AA Change: T107A

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
Pfam:Collagen 68 123 3.7e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. The protein may bind both Gram-negative and Gram-positive bacteria via an extracellular, C-terminal, scavenger receptor cysteine-rich (SRCR) domain. In addition to short cytoplasmic and transmembrane domains, there is an extracellular spacer domain and a long, extracellular collagenous domain. The protein may form a trimeric molecule by the association of the collagenous domains of three identical polypeptide chains. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered spleen marginal zone architecture and impaired IgM responses to a pneumococcal polysaccharide vaccine. Mice homozygous for another null allele show increased susceptibility to bacterial pneumonia and enhanced inflammatory responses to inhaled particles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T G 8: 40,826,467 C632G probably damaging Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Agfg1 A G 1: 82,886,431 T447A probably damaging Het
Ankrd37 C T 8: 45,998,396 probably null Het
Apob A T 12: 8,006,282 D1555V probably damaging Het
Asxl3 T A 18: 22,521,792 probably benign Het
Brca2 C A 5: 150,544,935 D2242E probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdk5rap2 A T 4: 70,349,142 probably null Het
Cox10 A T 11: 63,976,352 Y273N probably damaging Het
Dcbld2 A T 16: 58,455,145 D408V probably damaging Het
Enam A T 5: 88,503,105 E824D probably damaging Het
Epm2aip1 T C 9: 111,273,341 Y461H probably damaging Het
Fam72a T A 1: 131,533,861 S95T probably damaging Het
Fiz1 A T 7: 5,009,168 V117D possibly damaging Het
Gm10355 C T 3: 101,307,060 noncoding transcript Het
Gm11595 A T 11: 99,772,141 C238S unknown Het
Gm7589 T G 9: 59,146,156 noncoding transcript Het
H6pd A T 4: 149,981,616 V771E probably damaging Het
Htt T C 5: 34,870,746 L1782P probably damaging Het
Il33 T C 19: 29,954,647 S147P probably benign Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Lrp2 G A 2: 69,537,638 probably benign Het
Map1b T C 13: 99,431,683 K1510R unknown Het
Mki67 T A 7: 135,695,256 K2683M probably damaging Het
Mki67 A T 7: 135,696,908 N2132K possibly damaging Het
Mmp15 T C 8: 95,372,351 V602A probably damaging Het
Mphosph10 T A 7: 64,378,800 M536L probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
N4bp2 G T 5: 65,808,153 V1182L probably benign Het
Nlrc5 C A 8: 94,521,783 F1715L probably null Het
Nsd2 T A 5: 33,893,538 V1253E probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1225 C A 2: 89,170,648 C188F probably damaging Het
Olfr1537 A T 9: 39,238,371 S18T probably benign Het
Olfr437 T A 6: 43,167,187 I43K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pi4ka A T 16: 17,307,718 N4K possibly damaging Het
Plxna4 A T 6: 32,158,015 I1751N probably damaging Het
Postn C A 3: 54,367,576 S122* probably null Het
Ppp4r4 A T 12: 103,612,815 R762* probably null Het
Rrm1 G T 7: 102,467,067 probably null Het
Rrp15 A G 1: 186,736,234 V195A probably benign Het
Rtl1 T A 12: 109,591,655 D1250V probably damaging Het
Rxrg T C 1: 167,631,219 probably benign Het
Scn10a T C 9: 119,665,928 K416E probably benign Het
Serping1 T C 2: 84,770,081 probably benign Het
Slc12a6 T C 2: 112,335,924 probably null Het
Smo A T 6: 29,759,586 Q639L possibly damaging Het
Synrg T C 11: 83,982,188 probably benign Het
Tars2 T C 3: 95,742,659 D470G probably damaging Het
Tln1 T C 4: 43,542,709 N1399S possibly damaging Het
Tmem131 A G 1: 36,838,038 V240A probably damaging Het
Tmem232 G A 17: 65,382,620 T500I probably benign Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Toporsl G A 4: 52,612,140 V678M possibly damaging Het
Vmn1r7 A T 6: 57,025,081 F65I probably damaging Het
Wdfy4 C T 14: 33,042,621 M2257I probably benign Het
Wdr20rt T A 12: 65,227,315 D344E probably benign Het
Xirp2 C T 2: 67,514,414 A2333V probably benign Het
Zfyve16 T C 13: 92,494,944 K1381R probably benign Het
Zscan18 G T 7: 12,774,176 P466T probably damaging Het
Other mutations in Marco
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Marco APN 1 120485703 missense probably benign
IGL01343:Marco APN 1 120494740 critical splice donor site probably null
IGL02117:Marco APN 1 120490954 missense probably benign 0.00
IGL02338:Marco APN 1 120494779 missense possibly damaging 0.90
IGL03293:Marco APN 1 120494795 missense probably benign 0.08
P0027:Marco UTSW 1 120474712 missense probably damaging 1.00
R1450:Marco UTSW 1 120476745 splice site probably benign
R1958:Marco UTSW 1 120484864 missense probably damaging 1.00
R2444:Marco UTSW 1 120494770 missense probably damaging 1.00
R2568:Marco UTSW 1 120494785 missense possibly damaging 0.86
R4740:Marco UTSW 1 120494770 missense probably damaging 1.00
R4979:Marco UTSW 1 120494225 missense probably benign 0.02
R5393:Marco UTSW 1 120485854 missense probably damaging 1.00
R5536:Marco UTSW 1 120504735 missense possibly damaging 0.85
R6022:Marco UTSW 1 120488565 missense probably benign 0.00
R6028:Marco UTSW 1 120490942 missense probably damaging 0.97
R6058:Marco UTSW 1 120476706 missense probably damaging 1.00
R7565:Marco UTSW 1 120474666 missense probably damaging 1.00
R7682:Marco UTSW 1 120494042 critical splice donor site probably null
T0722:Marco UTSW 1 120474712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCTGGGAAGCTGCTCTATTC -3'
(R):5'- AGCCACAAGGTCAAACTTGAACTGG -3'

Sequencing Primer
(F):5'- agccttccctccagacc -3'
(R):5'- CACATCTTTGTGGCTGAGC -3'
Posted On2013-06-11