Incidental Mutation 'R5833:4930505A04Rik'
ID449414
Institutional Source Beutler Lab
Gene Symbol 4930505A04Rik
Ensembl Gene ENSMUSG00000040919
Gene NameRIKEN cDNA 4930505A04 gene
Synonyms
MMRRC Submission 043221-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5833 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30426006-30471827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30426349 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 173 (V173M)
Ref Sequence ENSEMBL: ENSMUSP00000045288 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000041763
AA Change: V173M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000152718
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 95.7%
  • 20x: 84.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,958,314 Y1161H probably damaging Het
Adcy2 T A 13: 68,738,603 M276L probably benign Het
Adi1 A G 12: 28,681,042 D166G probably benign Het
Arhgap44 T G 11: 65,038,677 E267A probably damaging Het
Arl11 T A 14: 61,311,062 L107Q probably damaging Het
C1qtnf3 A G 15: 10,975,630 D247G probably benign Het
C4b T C 17: 34,730,673 D1481G probably damaging Het
Cacna1a T C 8: 84,518,697 F242L probably damaging Het
Ccnl1 T C 3: 65,948,501 K298E probably benign Het
Dcaf5 A G 12: 80,348,429 V322A probably damaging Het
Ddr2 T C 1: 170,004,696 N175S probably benign Het
Enox1 T A 14: 77,506,939 M21K probably benign Het
Fhad1 T C 4: 142,002,527 D55G probably damaging Het
Gm5157 A G 7: 21,185,393 M75T possibly damaging Het
Gm6309 A G 5: 146,168,318 S262P probably damaging Het
Gpnmb T C 6: 49,044,018 L82P probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Itpripl2 A C 7: 118,489,971 V455G probably benign Het
Kif16b A G 2: 142,707,367 V1087A probably benign Het
Med12l A G 3: 59,265,226 D1801G possibly damaging Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mtmr4 T A 11: 87,605,049 Y570* probably null Het
Osbpl1a G T 18: 12,788,362 N128K probably damaging Het
Pcdhb5 T A 18: 37,321,102 H178Q probably damaging Het
Pdlim1 A T 19: 40,230,545 F214Y probably damaging Het
Qk A T 17: 10,216,387 L236H probably damaging Het
Rexo2 G T 9: 48,468,871 D220E probably benign Het
Rras A G 7: 45,021,291 E195G possibly damaging Het
Serpinb11 T C 1: 107,377,662 probably null Het
Sp1 T A 15: 102,430,917 M430K possibly damaging Het
Tardbp A C 4: 148,617,660 V86G probably damaging Het
Trim43c A G 9: 88,843,037 Q203R possibly damaging Het
Vmn1r232 A G 17: 20,913,651 L229P probably damaging Het
Other mutations in 4930505A04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:4930505A04Rik APN 11 30454843 missense possibly damaging 0.69
IGL01545:4930505A04Rik APN 11 30426228 missense probably benign 0.13
R0400:4930505A04Rik UTSW 11 30426360 missense probably benign 0.09
R1029:4930505A04Rik UTSW 11 30426177 missense probably damaging 0.96
R1029:4930505A04Rik UTSW 11 30446389 splice site probably benign
R1585:4930505A04Rik UTSW 11 30427175 splice site probably benign
R4708:4930505A04Rik UTSW 11 30454717 missense probably damaging 0.98
R4993:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4994:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4995:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4996:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5187:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5189:4930505A04Rik UTSW 11 30426169 missense probably damaging 0.97
R5330:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5333:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5448:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5449:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5450:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5475:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5477:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5665:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5823:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5832:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5835:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5873:4930505A04Rik UTSW 11 30426220 nonsense probably null
R6032:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6032:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6037:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6037:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6058:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6224:4930505A04Rik UTSW 11 30454815 missense probably benign 0.44
RF046:4930505A04Rik UTSW 11 30426249 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCAGCAACTCTTGGGAATTC -3'
(R):5'- CACAGGCTCTTCTCTGACTG -3'

Sequencing Primer
(F):5'- CCAGCAACTCTTGGGAATTCTGTTG -3'
(R):5'- ACAGGCTCTTCTCTGACTGTTTTAC -3'
Posted On2016-12-20